G2221860



Basic Information


Item Value
gene id G2221860
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050570.1
NCBI id CM025857.1
chromosome length 46327593
location 30070880 ~ 30071232 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2541188
gttgccacccctattactagcctgttcaacctctctttcgtgtcgtctgagattcccaaagattggaaagcagctgcggtcatccccctcttcaaagggggggacactcttgacccaaactgctacagacctatatctatcctaccatgcctttctaaggtcttcgaaagccaagtcaacaaacagattaccgaccattttgaatctcaccataccttctctgctatacaatctggtttcagagctggtcatgggtgcacctcagccacgctcaaggtcctaaacgatatcttaaccgccatcgataagaaacattactgtgcagccgtattcattgatctggccaaggcttt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2541188 True 353 lncRNA 0.47 1 30070880 30071232

Neighbor


gene id symbol gene type direction distance location
LOC110521697 LOC106584145 coding downstream 78803 29893802 ~ 29992077 (-)
LOC110521698 NA coding downstream 110005 29959053 ~ 29960875 (-)
LOC110521696 LOC106584092 coding downstream 333475 29710512 ~ 29737405 (-)
LOC110521695 LOC106584091 coding downstream 398041 29670113 ~ 29672839 (-)
LOC110521694 LOC106584144 coding downstream 419486 29634764 ~ 29651394 (-)
LOC110521699 LOC106584146 coding upstream 397387 30468619 ~ 30537355 (-)
uchl5 LOC106584153 coding upstream 815396 30886628 ~ 30901651 (-)
LOC118945813 NA coding upstream 845612 30916844 ~ 30922903 (-)
LOC110520953 NA coding upstream 1180358 31251582 ~ 31254143 (-)
LOC110521709 LOC106584156 coding upstream 1211772 31283004 ~ 31287087 (-)
G2221553 NA non-coding downstream 235658 29834957 ~ 29835222 (-)
G2221552 NA non-coding downstream 236152 29834392 ~ 29834728 (-)
G2221538 NA non-coding downstream 245565 29820088 ~ 29825315 (-)
G2221528 NA non-coding downstream 252607 29817958 ~ 29818273 (-)
G2221497 NA non-coding downstream 275710 29794932 ~ 29795170 (-)
G2222144 NA non-coding upstream 110555 30181787 ~ 30190913 (-)
G2222248 NA non-coding upstream 282268 30353500 ~ 30353716 (-)
G2222249 NA non-coding upstream 282905 30354137 ~ 30354340 (-)
G2222252 NA non-coding upstream 287941 30359173 ~ 30359483 (-)
G2222262 NA non-coding upstream 314691 30385923 ~ 30386440 (-)
G2221180 NA other downstream 597205 29468643 ~ 29473675 (-)
lnx1 lnx1 other downstream 1688605 28307617 ~ 28382340 (-)
G2219602 NA other downstream 2206812 27863404 ~ 27864068 (-)
G2219594 NA other downstream 2225479 27844874 ~ 27845401 (-)
LOC110521640 LOC106584214 other downstream 2890492 27157549 ~ 27180815 (-)
G2223487 NA other upstream 1203488 31274720 ~ 31275143 (-)
G2224948 NA other upstream 2350500 32421732 ~ 32422047 (-)
G2226519 NA other upstream 3557890 33629122 ~ 33629894 (-)
LOC110521741 LOC106584188 other upstream 3628648 33686041 ~ 33710890 (-)
G2226745 NA other upstream 3738147 33809379 ~ 33809894 (-)

Expression


G2221860 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G2221860 Expression in each Bioproject

Bar chart with 17 bars.
G2221860 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network