G2222692



Basic Information


Item Value
gene id G2222692
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050570.1
NCBI id CM025857.1
chromosome length 46327593
location 30699277 ~ 30699479 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2542051
caaattacttcataaaggaaaacatccctagcgggcggaacagaaatgacagcttgttacacaaaagaaaaggggctgggtttgagtgaaagagcgggaagactgaggaacaaagggcgaagctgtgctatcgtaaatacagtatcttatgcattctaaattaccgcccatttggaaaaggaaaatgcaataaatatttactc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2542051 True 203 lncRNA 0.40 1 30699277 30699479
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110521699 LOC106584146 coding downstream 161922 30468619 ~ 30537355 (-)
LOC110521697 LOC106584145 coding downstream 707200 29893802 ~ 29992077 (-)
LOC110521698 NA coding downstream 738402 29959053 ~ 29960875 (-)
LOC110521696 LOC106584092 coding downstream 961872 29710512 ~ 29737405 (-)
LOC110521695 LOC106584091 coding downstream 1026438 29670113 ~ 29672839 (-)
uchl5 LOC106584153 coding upstream 187149 30886628 ~ 30901651 (-)
LOC118945813 NA coding upstream 217365 30916844 ~ 30922903 (-)
LOC110520953 NA coding upstream 552111 31251582 ~ 31254143 (-)
LOC110521709 LOC106584156 coding upstream 583525 31283004 ~ 31287087 (-)
LOC110521710 LOC106584157 coding upstream 710992 31410471 ~ 31453380 (-)
G2222655 NA non-coding downstream 26279 30672092 ~ 30672998 (-)
G2222640 NA non-coding downstream 36712 30662222 ~ 30662565 (-)
G2222634 NA non-coding downstream 39408 30659655 ~ 30659869 (-)
G2222628 NA non-coding downstream 44765 30654169 ~ 30654512 (-)
G2222594 LOC106590943 non-coding downstream 73909 30625098 ~ 30625368 (-)
G2222734 NA non-coding upstream 26881 30726360 ~ 30726659 (-)
G2222745 NA non-coding upstream 33610 30733089 ~ 30733314 (-)
G2222835 NA non-coding upstream 89630 30789109 ~ 30789339 (-)
G2222836 NA non-coding upstream 90906 30790385 ~ 30790607 (-)
G2223019 NA non-coding upstream 173051 30872530 ~ 30872748 (-)
G2221180 NA other downstream 1225602 29468643 ~ 29473675 (-)
lnx1 lnx1 other downstream 2317002 28307617 ~ 28382340 (-)
G2219602 NA other downstream 2835209 27863404 ~ 27864068 (-)
G2219594 NA other downstream 2853876 27844874 ~ 27845401 (-)
LOC110521640 LOC106584214 other downstream 3518889 27157549 ~ 27180815 (-)
G2223487 NA other upstream 575241 31274720 ~ 31275143 (-)
G2224948 NA other upstream 1722253 32421732 ~ 32422047 (-)
G2226519 NA other upstream 2929643 33629122 ~ 33629894 (-)
LOC110521741 LOC106584188 other upstream 3000401 33686041 ~ 33710890 (-)
G2226745 NA other upstream 3109900 33809379 ~ 33809894 (-)

Expression


G2222692 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G2222692 Expression in each Bioproject

Bar chart with 19 bars.
G2222692 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network