G2226034



Basic Information


Item Value
gene id G2226034
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050570.1
NCBI id CM025857.1
chromosome length 46327593
location 33712804 ~ 33713050 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2545649
TGGTTATGTAAACTGTAGCTTGTGTCAACCGCAAGTATTTATCCAAAGCGTTTGAAACGAGCAAATGTGTAGGCCTACTGCACATTAGAGAAAAGAGACCTCTTGGACACTATTTGACCAATCAACAGTGTGCATCTCAATCAAGAGGAAGAGATAGGAGTCAGACTGTGTTGACTATTCAGGAAGGAATGGATAAAGTATGTATCAACATCTCTAATTTCATTATTGTGTATGCTGACCTGTATCT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2545649 True 247 lncRNA 0.39 1 33712804 33713050

Neighbor


gene id symbol gene type direction distance location
LOC110521740 LOC106584187 coding upstream 47840 33662429 ~ 33664964 (+)
LOC110521738 LOC106584184 coding upstream 155023 33434085 ~ 33557781 (+)
LOC110521735 LOC106584183 coding upstream 282183 33381409 ~ 33430621 (+)
LOC110521733 LOC106584181 coding upstream 334377 33040140 ~ 33378427 (+)
LOC110521731 LOC106584179 coding upstream 1115304 32491177 ~ 32597500 (+)
LOC110520955 rn138 coding downstream 796994 34510044 ~ 34513894 (+)
LOC110521747 LOC106584197 coding downstream 823794 34536844 ~ 34685436 (+)
LOC110521749 LOC106564818 coding downstream 983026 34696076 ~ 34707381 (+)
eef1db LOC106584198 coding downstream 1012576 34725626 ~ 34737477 (+)
LOC110521754 NA coding downstream 1030526 34743576 ~ 34746900 (+)
G2226009 NA non-coding upstream 1204 33667584 ~ 33711600 (+)
G2225992 NA non-coding upstream 70112 33641232 ~ 33642692 (+)
G2225989 NA non-coding upstream 74072 33638407 ~ 33638732 (+)
G2225985 NA non-coding upstream 82406 33630019 ~ 33630398 (+)
G2225928 NA non-coding upstream 169299 33543216 ~ 33543505 (+)
G2226036 NA non-coding downstream 6040 33719090 ~ 33721033 (+)
G2226643 NA non-coding downstream 75306 33788356 ~ 33788557 (+)
G2226651 NA non-coding downstream 83240 33796290 ~ 33796590 (+)
G2226660 NA non-coding downstream 97807 33810857 ~ 33811167 (+)
G2226676 NA non-coding downstream 122339 33835389 ~ 33836700 (+)
G2225948 NA other upstream 107910 33572140 ~ 33604894 (+)
LOC110521703 LOC106584150 other upstream 2846282 30863624 ~ 30866524 (+)
G2220253 NA other upstream 4690922 29021586 ~ 29021882 (+)
G2219991 NA other upstream 5163326 28549029 ~ 28549478 (+)
G2219989 LOC105940532 other upstream 5164720 28547538 ~ 28548084 (+)
LOC110521757 NA other downstream 1468919 35181902 ~ 35190209 (+)
G2228777 NA other downstream 1805184 35518234 ~ 35519242 (+)
LOC110521768 sirt5 other downstream 1980260 35693310 ~ 35735400 (+)
LOC110521770 igfbp-1a2 other downstream 2087982 35800643 ~ 35805071 (+)
insl5a rel3 other downstream 3871976 37584989 ~ 37587002 (+)

Expression


G2226034 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G2226034 Expression in each Bioproject

Bar chart with 1 bar.
G2226034 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network