G2228480



Basic Information


Item Value
gene id G2228480
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050570.1
NCBI id CM025857.1
chromosome length 46327593
location 35261666 ~ 35261896 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2548218
gtatttatcatcattagtcatttaggtcaacattggatcattcagagatcctcactgaacttctggagagagtttgctgcactgaaagtaaaggggctgaataattttgcacgcccaatttttcagtttttgatttgttaaaaaagtttgaaatagtcaataaatgtcgttccacttcatgattgtgtcccacttgttgttgattcttcacaaaaaaatacagttttatat

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2548218 True 231 lncRNA 0.33 1 35261666 35261896
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110521759 LOC106584097 coding downstream 41977 35216708 ~ 35219689 (-)
LOC110521758 LOC106584076 coding downstream 56474 35197810 ~ 35205192 (-)
LOC110521756 LOC106584201 coding downstream 92396 35166887 ~ 35169270 (-)
LOC110521753 LOC106584200 coding downstream 503520 34742934 ~ 34758146 (-)
LOC110521746 LOC106584195 coding downstream 778091 34398316 ~ 34483575 (-)
irf4l irf4 coding upstream 232058 35493954 ~ 35500738 (-)
LOC110521763 LOC106584075 coding upstream 238092 35499988 ~ 35514392 (-)
LOC110520993 LOC106584074 coding upstream 283680 35545576 ~ 35577047 (-)
phactr1 LOC106584070 coding upstream 380501 35642397 ~ 35717855 (-)
LOC110521771 igfbp-3a2 coding upstream 548672 35810568 ~ 35873392 (-)
G2228432 NA non-coding downstream 48458 35212977 ~ 35213208 (-)
G2228422 NA non-coding downstream 69030 35192424 ~ 35192636 (-)
G2228421 NA non-coding downstream 69473 35191957 ~ 35192193 (-)
G2228417 NA non-coding downstream 72081 35188643 ~ 35189585 (-)
G2228407 NA non-coding downstream 88443 35173009 ~ 35173223 (-)
G2228501 NA non-coding upstream 12995 35274891 ~ 35275139 (-)
G2228608 NA non-coding upstream 82962 35344858 ~ 35345128 (-)
G2228611 NA non-coding upstream 84151 35346047 ~ 35346268 (-)
G2228613 NA non-coding upstream 85118 35347014 ~ 35347311 (-)
G2228625 NA non-coding upstream 97071 35358967 ~ 35359234 (-)
G2227801 NA other downstream 719047 34542217 ~ 34542619 (-)
G2227478 NA other downstream 938011 34311142 ~ 34323655 (-)
G2226745 NA other downstream 1451772 33809379 ~ 33809894 (-)
LOC110521741 LOC106584188 other downstream 1559223 33686041 ~ 33710890 (-)
G2226519 NA other downstream 1631772 33629122 ~ 33629894 (-)
G2229175 NA other upstream 536908 35798804 ~ 35799357 (-)
G2229647 NA other upstream 951250 36213146 ~ 36214385 (-)
LOC110521777 LOC106584061 other upstream 1258456 36520352 ~ 36541228 (-)
LOC110521791 LOC106584041 other upstream 2239314 37498832 ~ 37523064 (-)
G2232820 NA other upstream 3503526 38765422 ~ 38767903 (-)

Expression


G2228480 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

G2228480 Expression in each Bioproject

Bar chart with 10 bars.
G2228480 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 250.
End of interactive chart.

Co-expression Network