G2228618



Basic Information


Item Value
gene id G2228618
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050570.1
NCBI id CM025857.1
chromosome length 46327593
location 35350907 ~ 35351262 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2548358
atgtactgtcatgttgtgtcttgtctctgtcctttcccttcaccctgtctccctctgctggtcgttgttaggttaccttttctccccctctttcccccagctgtgccttgtctcctcctaaccacctcgtcaccccttttcccacctgttccctttttccctctgattagtcccctatatctctctctgtttttgttcctgtccttgtcggattcttgtttgttgtgtttcatgcctgaaccagactatcgtcctgtttgctgtaaccttgtcctgtcctgtcggaatctgccggtctatctgagcctacctacgtttggttattaaagaagctctgtttaagttagttcgctttt

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2548358 True 356 lncRNA 0.47 1 35350907 35351262
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110521757 NA coding upstream 160698 35181902 ~ 35190209 (+)
LOC118945793 NA coding upstream 234149 34960599 ~ 35116758 (+)
LOC110521755 NA coding upstream 418270 34927630 ~ 34932637 (+)
LOC110521751 LOC106584199 coding upstream 514634 34776810 ~ 34836273 (+)
LOC110521754 NA coding upstream 604007 34743576 ~ 34746900 (+)
LOC110521760 LOC100380722 coding downstream 54307 35405569 ~ 35492375 (+)
psmg4 psmg4 coding downstream 192245 35543507 ~ 35545435 (+)
wu:fi04e12 LOC106584072 coding downstream 231011 35582273 ~ 35618259 (+)
tbc1d7 tbc1d7 coding downstream 268657 35619919 ~ 35634039 (+)
LOC110521768 sirt5 coding downstream 372634 35693310 ~ 35735400 (+)
G2228552 NA non-coding upstream 10595 35340082 ~ 35340312 (+)
G2228545 NA non-coding upstream 19467 35328894 ~ 35331440 (+)
G2228502 NA non-coding upstream 74362 35276309 ~ 35276545 (+)
G2228488 NA non-coding upstream 82092 35268538 ~ 35268815 (+)
G2228447 NA non-coding upstream 99429 35240437 ~ 35251478 (+)
G2228630 NA non-coding downstream 9973 35361235 ~ 35361470 (+)
G2228635 LOC107756720 non-coding downstream 15720 35366982 ~ 35367318 (+)
G2228636 NA non-coding downstream 16860 35368122 ~ 35368472 (+)
G2228660 NA non-coding downstream 121771 35473033 ~ 35476756 (+)
G2228782 NA non-coding downstream 174221 35525483 ~ 35525695 (+)
G2225948 NA other upstream 1746013 33572140 ~ 33604894 (+)
LOC110521703 LOC106584150 other upstream 4484385 30863624 ~ 30866524 (+)
G2220253 NA other upstream 6329025 29021586 ~ 29021882 (+)
G2219991 NA other upstream 6801429 28549029 ~ 28549478 (+)
G2228777 NA other downstream 166972 35518234 ~ 35519242 (+)
LOC110521770 igfbp-1a2 other downstream 449770 35800643 ~ 35805071 (+)
insl5a rel3 other downstream 2233764 37584989 ~ 37587002 (+)
G2231371 NA other downstream 2972098 38315783 ~ 38336981 (+)

Expression


G2228618 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G2228618 Expression in each Bioproject

Bar chart with 18 bars.
G2228618 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network