G2228942



Basic Information


Item Value
gene id G2228942
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050570.1
NCBI id CM025857.1
chromosome length 46327593
location 35799127 ~ 35799518 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2548704
tccttgggatgtttaaagcttgggaaatctttttgtatccaaatctggctttaaacttcttcacaacagtatctcggacctgcctggtgtgttccttgttcttcatgatgctctctgcgcttttaatggacctctgagacaggtgcatttatacggagacttgattacacacaggtggattgtatttatcatcattagtcatttaggtcaacattggatcattcagagatcctcactgaacttctggagagagtttgctgcactgaaagtaaaggggctgaataattttgcacgcccaatttttcagtttttgatttgttaaaaaagtttgaaatatccaataaatgtcgttccacttcatgattgtgtcccacttgttgttgattcgtcac

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2548704 True 392 lncRNA 0.39 1 35799127 35799518
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110521768 sirt5 coding upstream 64167 35693310 ~ 35735400 (+)
tbc1d7 tbc1d7 coding upstream 165088 35619919 ~ 35634039 (+)
wu:fi04e12 LOC106584072 coding upstream 180868 35582273 ~ 35618259 (+)
psmg4 psmg4 coding upstream 253692 35543507 ~ 35545435 (+)
LOC110521760 LOC100380722 coding upstream 306752 35405569 ~ 35492375 (+)
LOC110521770 igfbp-1a2 coding downstream 1125 35800643 ~ 35805071 (+)
LOC110520994 LOC106584065 coding downstream 203791 36003309 ~ 36062700 (+)
LOC110520956 LOC106583994 coding downstream 639094 36438612 ~ 36489124 (+)
LOC110521776 LOC106584062 coding downstream 703633 36503151 ~ 36517233 (+)
LOC118945799 NA coding downstream 715284 36514802 ~ 36516539 (+)
G2228932 NA non-coding upstream 19370 35779477 ~ 35779757 (+)
G2228834 NA non-coding upstream 155251 35641442 ~ 35643876 (+)
G2228833 NA non-coding upstream 160648 35638023 ~ 35638479 (+)
G2228812 NA non-coding upstream 161936 35635563 ~ 35637191 (+)
G2228814 NA non-coding upstream 163821 35634957 ~ 35635306 (+)
G2228968 NA non-coding downstream 45265 35844783 ~ 35846275 (+)
G2229262 NA non-coding downstream 100980 35900498 ~ 35902779 (+)
G2229268 NA non-coding downstream 110587 35910105 ~ 35910623 (+)
G2229270 NA non-coding downstream 113030 35912548 ~ 35912774 (+)
G2229355 NA non-coding downstream 171518 35971036 ~ 35971255 (+)
G2228777 NA other upstream 279885 35518234 ~ 35519242 (+)
LOC110521757 NA other upstream 608976 35181902 ~ 35190209 (+)
G2225948 NA other upstream 2194233 33572140 ~ 33604894 (+)
LOC110521703 LOC106584150 other upstream 4932605 30863624 ~ 30866524 (+)
insl5a rel3 other downstream 1785508 37584989 ~ 37587002 (+)
G2231371 NA other downstream 2523842 38315783 ~ 38336981 (+)
G2232661 LOC105030512 other downstream 2990797 38790315 ~ 38790675 (+)
G2232855 LOC100380853 other downstream 3013132 38812650 ~ 38813379 (+)

Expression


G2228942 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G2228942 Expression in each Bioproject

Bar chart with 12 bars.
G2228942 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.

Co-expression Network