G2232820



Basic Information


Item Value
gene id G2232820
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050570.1
NCBI id CM025857.1
chromosome length 46327593
location 38765422 ~ 38767903 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2552914
atggagccaaatacaggaccattctggaagaaaacctgatggagtctgcaaaagacctgagactgggacggagatttgtcttccaacaagacaatgatccaaaacataaagcaaaatctacaatggaatggttcaaaaataaacatatccaggtgttagaatggccaagtcaaagtccagacctgaatccaatcgagaatctgtggaaagaactgaaaactgctgttcacaaatgctctccatccaacctcactgagctcgagctgttttgcaaggaggaatgggaaaaaatgtcagtctctcgatgtgcaaaactgatagacacataccccaagcgacttacagctgtaatcgcagcaaaaggtggcgctacaaagtattaacttaagggggctgaataattttgcacgcccaatttttcggtttttgatttgttaaaaaagtttgaaatatccaataaatgtcgttccacttcatgattgtgtcccacttgt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2552914 True 494 TUCP 0.41 2 38765422 38767903

Neighbor


gene id symbol gene type direction distance location
LOC110521805 pgm1 coding downstream 5459 38747442 ~ 38759963 (-)
LOC110521804 LOC106584030 coding downstream 55361 38513982 ~ 38710061 (-)
LOC110521803 LOC106584031 coding downstream 300831 38384191 ~ 38464591 (-)
LOC110521000 LOC106584032 coding downstream 387305 38287397 ~ 38378117 (-)
LOC110521798 LOC106584033 coding downstream 543488 38216927 ~ 38221934 (-)
LOC118945819 NA coding upstream 7627 38775530 ~ 38780089 (-)
LOC110521806 NA coding upstream 71001 38838904 ~ 38856693 (-)
LOC110521808 LOC106584029 coding upstream 94578 38862481 ~ 38864063 (-)
LOC110521809 LOC106584028 coding upstream 382802 39150705 ~ 39155800 (-)
LOC110521002 NA coding upstream 435506 39203409 ~ 39260235 (-)
G2232817 NA non-coding downstream 2691 38761062 ~ 38762731 (-)
G2232811 NA non-coding downstream 19984 38744900 ~ 38745438 (-)
G2232808 NA non-coding downstream 22764 38742422 ~ 38742658 (-)
G2232720 NA non-coding downstream 100631 38607253 ~ 38664791 (-)
G2232716 NA non-coding downstream 167404 38597683 ~ 38598018 (-)
G2232823 NA non-coding upstream 1489 38769392 ~ 38769596 (-)
G2232826 NA non-coding upstream 3701 38771604 ~ 38771805 (-)
G2232828 NA non-coding upstream 6639 38774542 ~ 38774857 (-)
G2232835 NA non-coding upstream 13641 38781544 ~ 38781755 (-)
G2232836 NA non-coding upstream 14096 38781999 ~ 38782217 (-)
LOC110521791 LOC106584041 other downstream 1242416 37498832 ~ 37523064 (-)
LOC110521777 LOC106584061 other downstream 2240625 36520352 ~ 36541228 (-)
G2229647 NA other downstream 2551037 36213146 ~ 36214385 (-)
G2229175 NA other downstream 2966065 35798804 ~ 35799357 (-)
G2227801 NA other downstream 4222803 34542217 ~ 34542619 (-)
G2234611 NA other upstream 1189012 39956915 ~ 39993914 (-)
G2234837 NA other upstream 1517751 40285654 ~ 40286282 (-)
G2237502 NA other upstream 3512853 42280756 ~ 42281362 (-)
G2237814 NA other upstream 3974991 42742894 ~ 42743592 (-)

Expression


G2232820 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G2232820 Expression in each Bioproject

Bar chart with 20 bars.
G2232820 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network