G2236045



Basic Information


Item Value
gene id G2236045
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050570.1
NCBI id CM025857.1
chromosome length 46327593
location 41385660 ~ 41385993 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2556385
agtgaaaacctccttccatcagcaagggcaatgaagatgaaacgtggctgggtctttcagcatgacaatgatcccaaacacaccgcccgggcaacgaaggagtggcttcgtaagaagcatttcaaggtcctggagtggcctagccagtctctagatctcaaccccatagaaaatctttggagggagttgaaagtccgtgttgcccagcaacagccccaaaacatcactgctctagaggagatctgcatggaggaatgggccaaaataccagcaacagtgtgtgaaaaccttgaagacttacagaaaatgtttgacctctgtcattgccaacaaa

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2556385 True 334 TUCP 0.48 1 41385660 41385993

Neighbor


gene id symbol gene type direction distance location
LOC110521828 LOC106584006 coding upstream 227659 41101017 ~ 41158001 (+)
pik3r3b LOC106584012 coding upstream 917081 40143590 ~ 40468579 (+)
LOC118945792 NA coding upstream 1425564 39959297 ~ 39960096 (+)
LOC110521823 pomgnt1 coding upstream 1427743 39931006 ~ 39957917 (+)
LOC110521822 pr38a coding upstream 1461159 39920864 ~ 39924501 (+)
LOC110521832 LOC106583970 coding downstream 72888 41458881 ~ 41467520 (+)
LOC110520957 LOC106583970 coding downstream 91492 41477485 ~ 41478421 (+)
LOC110521005 LOC106560551 coding downstream 626582 42012575 ~ 42053669 (+)
LOC110521838 LOC106583933 coding downstream 940266 42326259 ~ 42506540 (+)
LOC110521840 LOC106583968 coding downstream 1162335 42548328 ~ 42554269 (+)
G2235948 NA non-coding upstream 77287 41308102 ~ 41308373 (+)
G2235936 NA non-coding upstream 84368 41300954 ~ 41301292 (+)
G2235584 LOC106584002 non-coding upstream 104319 41267894 ~ 41281341 (+)
G2235525 NA non-coding upstream 297382 41088064 ~ 41088278 (+)
G2236056 LOC106583972 non-coding downstream 36767 41422760 ~ 41423594 (+)
G2236181 NA non-coding downstream 109524 41495517 ~ 41495787 (+)
G2236226 NA non-coding downstream 166518 41552511 ~ 41553042 (+)
G2236227 NA non-coding downstream 167092 41553085 ~ 41554453 (+)
G2236228 NA non-coding downstream 168470 41554463 ~ 41554733 (+)
LOC110521817 LOC106584021 other upstream 1577610 39800038 ~ 39812756 (+)
LOC110521001 LOC106584026 other upstream 2208967 39117484 ~ 39202411 (+)
G2232855 LOC100380853 other upstream 2572281 38812650 ~ 38813379 (+)
G2237341 NA other downstream 1343859 42729852 ~ 42730451 (+)
G2238623 adgrl4 other downstream 2054860 43440853 ~ 43465829 (+)
G2238671 LOC100136747 other downstream 2222588 43608581 ~ 43623303 (+)
G2239435 LOC106583900 other downstream 3013892 44399885 ~ 44427686 (+)

Expression


G2236045 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 50.
End of interactive chart.

G2236045 Expression in each Bioproject

Bar chart with 20 bars.
G2236045 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network