G2238261



Basic Information


Item Value
gene id G2238261
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050570.1
NCBI id CM025857.1
chromosome length 46327593
location 42822396 ~ 42822706 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2558769
caggtacacctccaattgattcaaattatttcaattagccaatcagaagcttctaaagccatgacatcatttcctggaattttccaagctgtttaaaggcacagtcaacttagtgtatgtaaacttttgacccactggaattgtgatacagtgaattataagtgaaataatctgtctgtaaacaattgtttgaaaaatgacttgtgtcatgcacaaagtagatgtcctaaccgacttgccaaagctatagtttgttgacaagcgagttttaatgactccaacctaagtgtatgtaaacttccgacttcaac

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2558769 True 311 lncRNA 0.36 1 42822396 42822706
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110521841 LOC106583966 coding downstream 205672 42556881 ~ 42616724 (-)
LOC110521839 LOC106583969 coding downstream 271538 42526928 ~ 42550858 (-)
LOC110521837 NA coding downstream 509965 42294701 ~ 42312431 (-)
LOC110521836 LOC106583981 coding downstream 553538 42256238 ~ 42268858 (-)
LOC110521834 nek7 coding downstream 591534 42100595 ~ 42230862 (-)
LOC110521848 LOC106583960 coding upstream 241550 43064256 ~ 43082034 (-)
LOC118945796 NA coding upstream 310567 43133273 ~ 43134588 (-)
LOC110521850 LOC106583957 coding upstream 318012 43140718 ~ 43144980 (-)
LOC110521851 LOC106583956 coding upstream 329689 43152395 ~ 43175237 (-)
LOC110521854 LOC106583953 coding upstream 370936 43193642 ~ 43275036 (-)
G2238258 NA non-coding downstream 3664 42818494 ~ 42818732 (-)
G2238226 LOC106583964 non-coding downstream 39285 42754268 ~ 42783111 (-)
G2237817 NA non-coding downstream 74430 42747703 ~ 42747966 (-)
G2237799 NA non-coding downstream 99091 42722841 ~ 42723305 (-)
G2237786 NA non-coding downstream 116220 42705719 ~ 42706176 (-)
G2238263 NA non-coding upstream 3761 42826467 ~ 42826775 (-)
G2238265 NA non-coding upstream 6674 42829380 ~ 42829731 (-)
G2238273 NA non-coding upstream 20759 42843465 ~ 42915046 (-)
G2238313 NA non-coding upstream 66811 42889517 ~ 42926398 (-)
G2238394 NA non-coding upstream 204721 43027427 ~ 43027713 (-)
G2237814 NA other downstream 78804 42742894 ~ 42743592 (-)
G2237502 NA other downstream 541034 42280756 ~ 42281362 (-)
G2234837 NA other downstream 2536114 40285654 ~ 40286282 (-)
G2234611 NA other downstream 2828482 39956915 ~ 39993914 (-)
LOC110521806 NA other downstream 3965705 38838904 ~ 38856693 (-)
G2239635 LOC106583937 other upstream 1459430 44282136 ~ 44283368 (-)
G2240022 aldoa other upstream 1907527 44721963 ~ 44733310 (-)
LOC110521015 LOC106583894 other upstream 2147016 44950503 ~ 45003269 (-)
LOC110521929 LOC106583891 other upstream 3052565 45875271 ~ 45885821 (-)
G2241718 NA other upstream 3469204 46291910 ~ 46301730 (-)

Expression


G2238261 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G2238261 Expression in each Bioproject

Bar chart with 19 bars.
G2238261 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network