G2247806



Basic Information


Item Value
gene id G2247806
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050571.1
NCBI id CM025858.1
chromosome length 44108611
location 7237724 ~ 7238081 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2570596
gaaaagggtgtttagccccctcaagccaatgcctccacaccttcaaggcttctacgacagctaacagctctcggttccccacatcatagtttcgctccgccgggctgagcttcttcgaaaagaaagcacaggggcgaagcttcagtggcgtacccgaacgctgagagagcactgctcctatcccagcttcggatgcgtccacctccactatgaatggcaaagagggatccggatgagccaacacaggcaccgaggtaaacagagtcttcaggtgcccaaaagccctgttcgcctcagccgaccactgcaagcgcaccgggcccccctttagcagtgaggtaatgggagcagccacctg

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2570596 True 358 lncRNA 0.58 1 7237724 7238081
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110504506 LOC106612265 coding downstream 36224 7127869 ~ 7201500 (-)
LOC110504499 LOC106604166 coding downstream 815295 6116114 ~ 6422429 (-)
LOC118946011 NA coding downstream 1497672 5739294 ~ 5740052 (-)
LOC110504359 LOC106612272 coding downstream 1506718 5707418 ~ 5731006 (-)
LOC110504491 LOC106604157 coding downstream 1632944 5532859 ~ 5604780 (-)
LOC110504480 LOC106612296 coding upstream 460102 7698183 ~ 7725792 (-)
LOC110504483 LOC106612297 coding upstream 597162 7835243 ~ 7849870 (-)
LOC110504356 LOC106612292 coding upstream 620044 7858125 ~ 7871099 (-)
LOC110504484 smad5 coding upstream 633813 7871894 ~ 7892178 (-)
LOC110504485 tgfbi coding upstream 658630 7896711 ~ 7926759 (-)
G2247801 NA non-coding downstream 12777 7224226 ~ 7224947 (-)
G2247799 NA non-coding downstream 21875 7209516 ~ 7215849 (-)
G2247793 NA non-coding downstream 96372 7140527 ~ 7141352 (-)
G2247775 NA non-coding downstream 132402 7105093 ~ 7105322 (-)
G2247657 NA non-coding downstream 147759 7089060 ~ 7089965 (-)
G2247816 NA non-coding upstream 20607 7258688 ~ 7258920 (-)
G2247821 NA non-coding upstream 27132 7265213 ~ 7265524 (-)
G2247986 NA non-coding upstream 57927 7296008 ~ 7296299 (-)
G2247989 NA non-coding upstream 76970 7315051 ~ 7315250 (-)
G2247990 NA non-coding upstream 79917 7317998 ~ 7318222 (-)
G2247565 NA other downstream 213185 6938623 ~ 7024539 (-)
G2247416 NA other downstream 366624 6870587 ~ 6871100 (-)
G2246314 NA other downstream 1385125 5848119 ~ 5852599 (-)
G2245152 ctnna1 other downstream 2615734 4535841 ~ 4621990 (-)
G2244811 NA other downstream 3124723 4111702 ~ 4113001 (-)
G2247813 NA other upstream 17263 7255344 ~ 7255940 (-)
G2248522 NA other upstream 802795 8040876 ~ 8041480 (-)
G2248668 LOC106612284 other upstream 915830 8153911 ~ 8157963 (-)
c1qtnf2 c1qtnf2 other upstream 1908710 9145591 ~ 9148916 (-)
G2249506 NA other upstream 1911807 9149888 ~ 9150141 (-)

Expression


G2247806 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G2247806 Expression in each Bioproject

Bar chart with 20 bars.
G2247806 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network