G2249425



Basic Information


Item Value
gene id G2249425
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050571.1
NCBI id CM025858.1
chromosome length 44108611
location 9132891 ~ 9133136 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2572590
CCATCTGAAACACTCCTAGCAGTGGGGCTATGGTGGAGGATAAGGCCATCTGAAACACTCCTAGCAGTGGGGCTACGGTGGAGGATAAGGCCATCTGAAACACTCCTAGCAGTGGGGCAATGGTGGAGGATAAGACCATCTGAATGGAGATCTAGTCAGATAAGACACTAAGTAGAAGCCTGAAGCCTCTACATGTCAACCTCGCTTGCAGCCAGTCACATAAATACACAATTGCACAGACAAAAC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2572590 True 246 lncRNA 0.49 1 9132891 9133136
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110504364 ccdc69 coding upstream 195241 8901765 ~ 8937650 (+)
LOC118946015 NA coding upstream 212664 8918493 ~ 8920227 (+)
LOC118946014 NA coding upstream 215444 8912720 ~ 8917447 (+)
LOC118946016 NA coding upstream 225932 8903750 ~ 8906959 (+)
LOC110504544 LOC106612256 coding upstream 388221 8681832 ~ 8744670 (+)
LOC110504529 pp2aa coding downstream 78681 9211817 ~ 9221226 (+)
LOC110504533 sfxn1 coding downstream 90896 9224032 ~ 9248966 (+)
nudcd2 nudcd2 coding downstream 415251 9548387 ~ 9552601 (+)
gdf9 LOC106612229 coding downstream 451110 9584246 ~ 9590828 (+)
LOC110504554 LOC106604229 coding downstream 466942 9600078 ~ 9602977 (+)
G2249422 NA non-coding upstream 15588 9116961 ~ 9117303 (+)
G2249421 LOC106612241 non-coding upstream 16483 9116109 ~ 9116408 (+)
G2249420 NA non-coding upstream 19218 9113440 ~ 9113673 (+)
G2249419 NA non-coding upstream 21218 9111444 ~ 9111673 (+)
G2249416 NA non-coding upstream 29848 9102815 ~ 9103043 (+)
G2249431 c1qtnf2 non-coding downstream 12361 9145497 ~ 9146710 (+)
G2249504 NA non-coding downstream 16292 9149428 ~ 9150274 (+)
G2249512 NA non-coding downstream 23485 9156621 ~ 9156986 (+)
G2249513 NA non-coding downstream 26958 9160094 ~ 9163266 (+)
G2249544 NA non-coding downstream 67104 9200240 ~ 9200697 (+)
G2249418 LOC106612241 other upstream 21569 9106708 ~ 9111322 (+)
G2249058 NA other upstream 298516 8831981 ~ 8834375 (+)
G2247754 NA other upstream 1895962 7236526 ~ 7236929 (+)
G2247747 NA other upstream 1908045 7224214 ~ 7224846 (+)
G2247687 NA other upstream 1997633 7132731 ~ 7135258 (+)
G2249775 NA other downstream 348544 9481680 ~ 9557467 (+)
G2249785 LOC106604237 other downstream 353109 9486245 ~ 9486922 (+)
G2250462 NA other downstream 1095784 10228920 ~ 10229999 (+)
G2251174 NA other downstream 2063464 11196600 ~ 11199436 (+)

Expression


G2249425 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G2249425 Expression in each Bioproject

Bar chart with 12 bars.
G2249425 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network