G2249512



Basic Information


Item Value
gene id G2249512
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050571.1
NCBI id CM025858.1
chromosome length 44108611
location 9156621 ~ 9156986 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2572687
agtatagcatgatcaactgtatcaaaagccttagagagatcaataaaaagtgagacacagtgctgttttttgtcaatggcttcagtgatatcatttaaaaccttcatggctgctgtaattgtgctatgcttcttcctgaagcccgattggtacattgataaaatagagttagtaaataaaaactattttagctgttcacttacaagggttgcaagtattttcaccaggggtgacagctttgagattggcctataattatttgaaagagttggatctcccccttttaaaagtggtaggacaaatgctgatttccagaccttaggaatttcattacattccagggttagattgaacagatatgtaagt

Function


NR:

description
RNA-directed DNA polymerase from mobile element jockey

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2572687 True 366 lncRNA 0.36 1 9156621 9156986
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110504364 ccdc69 coding upstream 218971 8901765 ~ 8937650 (+)
LOC118946015 NA coding upstream 236394 8918493 ~ 8920227 (+)
LOC118946014 NA coding upstream 239174 8912720 ~ 8917447 (+)
LOC118946016 NA coding upstream 249662 8903750 ~ 8906959 (+)
LOC110504544 LOC106612256 coding upstream 411951 8681832 ~ 8744670 (+)
LOC110504529 pp2aa coding downstream 54831 9211817 ~ 9221226 (+)
LOC110504533 sfxn1 coding downstream 67046 9224032 ~ 9248966 (+)
nudcd2 nudcd2 coding downstream 391401 9548387 ~ 9552601 (+)
gdf9 LOC106612229 coding downstream 427260 9584246 ~ 9590828 (+)
LOC110504554 LOC106604229 coding downstream 443092 9600078 ~ 9602977 (+)
G2249504 NA non-coding upstream 6347 9149428 ~ 9150274 (+)
G2249431 c1qtnf2 non-coding upstream 9911 9145497 ~ 9146710 (+)
G2249425 NA non-coding upstream 23485 9132891 ~ 9133136 (+)
G2249422 NA non-coding upstream 39318 9116961 ~ 9117303 (+)
G2249421 LOC106612241 non-coding upstream 40213 9116109 ~ 9116408 (+)
G2249513 NA non-coding downstream 3108 9160094 ~ 9163266 (+)
G2249544 NA non-coding downstream 43254 9200240 ~ 9200697 (+)
G2249547 NA non-coding downstream 45385 9202371 ~ 9202609 (+)
G2249566 NA non-coding downstream 101191 9258177 ~ 9262805 (+)
G2249590 NA non-coding downstream 162340 9319326 ~ 9319637 (+)
G2249418 LOC106612241 other upstream 45299 9106708 ~ 9111322 (+)
G2249058 NA other upstream 322246 8831981 ~ 8834375 (+)
G2247754 NA other upstream 1919692 7236526 ~ 7236929 (+)
G2247747 NA other upstream 1931775 7224214 ~ 7224846 (+)
G2247687 NA other upstream 2021363 7132731 ~ 7135258 (+)
G2249775 NA other downstream 324694 9481680 ~ 9557467 (+)
G2249785 LOC106604237 other downstream 329259 9486245 ~ 9486922 (+)
G2250462 NA other downstream 1071934 10228920 ~ 10229999 (+)
G2251174 NA other downstream 2039614 11196600 ~ 11199436 (+)

Expression


G2249512 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G2249512 Expression in each Bioproject

Bar chart with 20 bars.
G2249512 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.

Co-expression Network