G2251933



Basic Information


Item Value
gene id G2251933
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050571.1
NCBI id CM025858.1
chromosome length 44108611
location 11594179 ~ 11614242 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2575698
ggcttcaaacataaagatataaaactgtattttttttgtgaagaatcaacaacaagtgggacacaatcatgaagtggaacgacatttattggatatttcaaacttttttaacaaatcaaaaactgaaaaattggccgtgcaaaattattcagcccctttactttcagtgcagcaaactctctccagtagttcagtgaggatctctgaatgatccaatgttgacctaaatgactaatgatgataaatacaatccacctgtgtgtaatcaagtctccgtataaatgcacctgcactgtgatagtctcagagggccgttaaaagcgcagagagcatcatgaagaacaaggaacacaccaggcaggtccgagatactgttgtgaagaagtttaaagccggatttggatacaaaaagatttcccaagctttaaacatcccaagga

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2575698 True 440 lncRNA 0.38 2 11594179 11614242
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110504558 LOC106612209 coding downstream 18143 11567458 ~ 11576036 (-)
LOC110504560 NA coding downstream 34454 11550643 ~ 11559725 (-)
LOC110504562 LOC106604327 coding downstream 57026 11511832 ~ 11537153 (-)
LOC110504561 LOC106612210 coding downstream 82709 11492835 ~ 11511470 (-)
LOC110504563 LOC106612212 coding downstream 111156 11481328 ~ 11483023 (-)
LOC118946012 LOC106612208 coding upstream 7186 11621428 ~ 11769905 (-)
LOC110504577 LOC106605487 coding upstream 334317 11948559 ~ 11960146 (-)
LOC118946085 LOC106612186 coding upstream 417833 12031779 ~ 12034798 (-)
LOC110504578 LOC106604272 coding upstream 500172 12114414 ~ 12121490 (-)
LOC110504289 hc127 coding upstream 529596 12143838 ~ 12154633 (-)
G2251858 NA non-coding downstream 148781 11445064 ~ 11445398 (-)
G2251857 NA non-coding downstream 149255 11444715 ~ 11444924 (-)
G2251847 NA non-coding downstream 173566 11420313 ~ 11420613 (-)
G2251846 NA non-coding downstream 179206 11414738 ~ 11414973 (-)
G2251946 NA non-coding upstream 357 11614599 ~ 11614997 (-)
G2251948 NA non-coding upstream 2069 11616311 ~ 11616544 (-)
G2251952 NA non-coding upstream 9529 11623771 ~ 11624129 (-)
G2251985 NA non-coding upstream 63442 11677684 ~ 11679156 (-)
G2251994 NA non-coding upstream 78718 11692960 ~ 11694588 (-)
G2251818 LOC106612215 other downstream 234669 11356212 ~ 11359510 (-)
ogt.1 LOC106604253 other downstream 339503 11214371 ~ 11254712 (-)
LOC118946018 NA other downstream 410800 11180007 ~ 11183379 (-)
G2252687 NA other upstream 855092 12469334 ~ 12471280 (-)
LOC110504591 NA other upstream 962987 12577123 ~ 12595742 (-)
LOC110504372 LOC106612156 other upstream 1100386 12702767 ~ 12716735 (-)
G2253147 LOC106612165 other upstream 1359829 12974071 ~ 12976617 (-)
G2253603 NA other upstream 1480558 13094800 ~ 13095093 (-)

Expression


G2251933 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G2251933 Expression in each Bioproject

Bar chart with 18 bars.
G2251933 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network