G2257409



Basic Information


Item Value
gene id G2257409
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050571.1
NCBI id CM025858.1
chromosome length 44108611
location 16700748 ~ 16701181 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2582282
GCAGAGGTCATGTGTGTGATGATGCAGCGGTCATGTGTGTAATGATGCAGAGGTCATGTGTGTGATGATGCAGCGGTCATGTGTGTAATGATGCAGCGGTCATGTGTGTGATGATGCAGCGGTCATGTGTGTAATGATGCAGAGGTCATGTGTGTGATGATGCAGCGGTCATGTGTGTAATGATGCAGAGGTCATGTGTGTGATGATGCAGCGGTCATGTGTGTGAT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2582282 True 227 lncRNA 0.49 2 16700748 16701181

Neighbor


gene id symbol gene type direction distance location
LOC110504678 LOC106612097 coding downstream 36299 16660952 ~ 16664449 (-)
nudt22 nudt22 coding downstream 80096 16616900 ~ 16620652 (-)
LOC110504676 LOC106612091 coding downstream 99862 16598540 ~ 16600886 (-)
LOC110504669 LOC106612087 coding downstream 148572 16459864 ~ 16552176 (-)
LOC110504680 LOC106612085 coding downstream 182674 16501304 ~ 16518074 (-)
LOC118946009 NA coding upstream 32662 16733843 ~ 16735589 (-)
LOC110504653 LOC106612100 coding upstream 37351 16719521 ~ 16819520 (-)
LOC110504390 LOC106604393 coding upstream 90269 16791450 ~ 16795459 (-)
LOC110504664 LOC106594957 coding upstream 130484 16831665 ~ 16838842 (-)
LOC110504389 LOC106604398 coding upstream 155575 16856756 ~ 16910805 (-)
G2257281 NA non-coding downstream 54735 16644638 ~ 16646013 (-)
G2257298 NA non-coding downstream 99437 16547490 ~ 16601311 (-)
G2257341 NA non-coding downstream 142224 16553913 ~ 16558524 (-)
G2257282 LOC106604382 non-coding downstream 155560 16542126 ~ 16545188 (-)
G2257271 NA non-coding downstream 160391 16538449 ~ 16540357 (-)
G2257440 NA non-coding upstream 55300 16756481 ~ 16822407 (-)
G2257457 NA non-coding upstream 128387 16829568 ~ 16830949 (-)
G2257463 NA non-coding upstream 135288 16836469 ~ 16836704 (-)
G2257466 NA non-coding upstream 143891 16845072 ~ 16845506 (-)
LOC110504385 gria1 other downstream 1057628 15627780 ~ 15813695 (-)
G2255363 NA other downstream 1427140 15272878 ~ 15273608 (-)
G2255168 NA other downstream 1590115 15110233 ~ 15110633 (-)
G2254275 NA other downstream 2600991 14099389 ~ 14099757 (-)
G2253906 NA other downstream 2860059 13798351 ~ 13840689 (-)
LOC110504656 psd2 other upstream 274418 16920549 ~ 16990970 (-)
LOC110504684 UBE2D2 other upstream 353857 17055003 ~ 17061580 (-)
G2257651 NA other upstream 644705 17264357 ~ 17349631 (-)
cnot7 LOC103366853 other upstream 1344732 18036030 ~ 18047530 (-)

Expression


G2257409 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G2257409 Expression in each Bioproject

Bar chart with 4 bars.
G2257409 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network