G2257681



Basic Information


Item Value
gene id G2257681
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050571.1
NCBI id CM025858.1
chromosome length 44108611
location 17360020 ~ 17360880 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2582617
CATAAATAGTGATATCCTATGATCAACCACTAGATGAGCTGTAGCAGTTTTTGCCTTGTTGTGAAAAAAGGCTGTAGTATTGCTAACTAACTGCATCAAAGAGAAGAGGTTGTAGTATGGCTAACTAACTGCATGACAGAGAAGAGGTTGTAGTATGGCTAACTAACTGCATCAAAGAGAAGAGGTTGTAGTATGGCTAACTAACTGCATCAAAGAGAAGAGGTTGTAGTATGGCTAACTAACTGTATGACAG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2582617 True 253 lncRNA 0.39 2 17360020 17360880
Loading

Neighbor


gene id symbol gene type direction distance location
gpc4 LOC106612107 coding downstream 24515 17273292 ~ 17335505 (-)
hs6st2 LOC106612108 coding downstream 87411 17266141 ~ 17272609 (-)
mbnl3 LOC106612109 coding downstream 94583 17179923 ~ 17265437 (-)
LOC110504690 LOC106612110 coding downstream 183280 17156328 ~ 17176740 (-)
LOC110504684 UBE2D2 coding downstream 298440 17055003 ~ 17061580 (-)
LOC118946076 NA coding upstream 349111 17708968 ~ 17712731 (-)
cab39l1 LOC106612044 coding upstream 358169 17719049 ~ 17735580 (-)
mospd1 mospd1 coding upstream 439203 17800083 ~ 17806503 (-)
mmgt1 tmm32 coding upstream 497125 17858005 ~ 17860307 (-)
her5 LOC106612050 coding upstream 526401 17887281 ~ 17889643 (-)
G2257676 NA non-coding downstream 8819 17350727 ~ 17351201 (-)
G2257651 NA non-coding downstream 12917 17264357 ~ 17349631 (-)
G2257667 NA non-coding downstream 22405 17337241 ~ 17337615 (-)
G2257619 NA non-coding downstream 196779 17161685 ~ 17163241 (-)
G2257683 NA non-coding upstream 339 17361219 ~ 17361563 (-)
G2257689 NA non-coding upstream 6270 17367150 ~ 17367357 (-)
G2257694 NA non-coding upstream 23072 17383952 ~ 17384550 (-)
G2257695 NA non-coding upstream 27518 17388398 ~ 17388882 (-)
G2257711 NA non-coding upstream 84962 17445842 ~ 17446051 (-)
LOC110504656 psd2 other downstream 369184 16920549 ~ 16990970 (-)
LOC110504653 LOC106612100 other downstream 540500 16719521 ~ 16819520 (-)
LOC110504385 gria1 other downstream 1716900 15627780 ~ 15813695 (-)
cnot7 LOC103366853 other upstream 685033 18036030 ~ 18047530 (-)
G2258072 pdgfrl other upstream 791150 18152030 ~ 18158267 (-)
G2258118 NA other upstream 869270 18230150 ~ 18230459 (-)
G2258266 NA other upstream 1007387 18368267 ~ 18368658 (-)
LOC110504725 LOC106612015 other upstream 1325558 18686438 ~ 18714368 (-)

Expression


G2257681 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G2257681 Expression in each Bioproject

Bar chart with 11 bars.
G2257681 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 500.
End of interactive chart.

Co-expression Network