G2259010



Basic Information


Item Value
gene id G2259010
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050571.1
NCBI id CM025858.1
chromosome length 44108611
location 19080377 ~ 19080583 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2584173
cctttgttttgttgacgttgagtgagaggttgtttcctgacaccacactccgagagccctcacctcctccctgtaggctgtctcgttgttgttggtaatcaagcccactactgttgtgtcatctgcaaacttgatgactgagttggaggtgtgcatggccacgcagtcatgggtgaacagggagtgcaggagggggctgagcatgca

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2584173 True 207 lncRNA 0.53 1 19080377 19080583

Neighbor


gene id symbol gene type direction distance location
ccdc142 ccdc142 coding upstream 85322 18988291 ~ 18995055 (+)
LOC110504743 slbp coding upstream 92331 18984434 ~ 18988046 (+)
tmem129 tmem129 coding upstream 97486 18979199 ~ 18982891 (+)
st3gal5 st3gal5 coding upstream 129617 18936856 ~ 18950760 (+)
polr1a polr1a coding upstream 145353 18923789 ~ 18935024 (+)
nkx1.2lb nkx1-1 coding downstream 57460 19138043 ~ 19145172 (+)
LOC110504746 ctbp1 coding downstream 102079 19182662 ~ 19200820 (+)
spon2b spon2 coding downstream 165227 19245810 ~ 19253829 (+)
LOC110504750 rnf212 coding downstream 175802 19256385 ~ 19260221 (+)
LOC110504396 LOC106611996 coding downstream 318916 19399499 ~ 19405412 (+)
G2258993 NA non-coding upstream 11552 19068593 ~ 19068825 (+)
G2258572 NA non-coding upstream 116348 18963804 ~ 18964029 (+)
G2258571 NA non-coding upstream 116962 18963173 ~ 18963415 (+)
G2258528 NA non-coding upstream 227468 18852365 ~ 18852909 (+)
G2258479 NA non-coding upstream 268317 18763539 ~ 18812060 (+)
G2259026 NA non-coding downstream 15154 19095737 ~ 19096085 (+)
G2259028 NA non-coding downstream 15550 19096133 ~ 19096574 (+)
G2259030 NA non-coding downstream 18216 19098799 ~ 19099041 (+)
G2259136 NA non-coding downstream 122556 19203139 ~ 19203371 (+)
micu3b LOC106612036 other upstream 1069582 17971133 ~ 18010807 (+)
G2256867 NA other upstream 1634447 17445566 ~ 17445930 (+)
G2256788 NA other upstream 1730032 17291119 ~ 17350345 (+)
G2256591 LOC106594957 other upstream 2246533 16828805 ~ 16833844 (+)
G2256563 LOC106612100 other upstream 2302352 16776894 ~ 16778025 (+)
LOC110504399 LOC106611959 other downstream 1507108 20587691 ~ 20876250 (+)
G2261028 NA other downstream 1866150 20946733 ~ 20947525 (+)
G2261334 NA other downstream 2362073 21442656 ~ 21443007 (+)
G2261414 fchsd1 other downstream 2671232 21751815 ~ 21772260 (+)
LOC110504779 LOC106612009 other downstream 2867241 21947801 ~ 21953127 (+)

Expression


G2259010 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G2259010 Expression in each Bioproject

Bar chart with 19 bars.
G2259010 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network