G2262875


Basic Information

Item Value
gene id G2262875
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_050571.1
NCBI id CM025858.1
chromosome length 44108611
location 22381142 ~ 22381967 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU2588370
gttgaagtcattaaatctagtttttcaaccactccacaaatttcttgttaacaaactatagttttggcaagtcggttaggacatctactttgtgcatgacacaagtcatttttccaacaattgttgacagacagattatttcacttataattcactgtatcacaattccagtgagtcagacgttttctgtgcctttaaacagcttggaaaattccagacaattatgtaatggctttagaagcttctgataggctaattgacatcatttgagacaattggaagtgtacctgtggatgtatttcaaggcctaccttccaactcagtgcctctttgcttgacatcatgggaaaatcaaaataaaccagaaaagacctcagaaaaaagattgtagacctccacaagtctggtttatccttgggagcaatttccaaacgcctgaaggtaccacgttcatctgtacaaacaatagtacgcaagtacgaacaccatgggaccacgcagttgtcataccgctcaggcatactgcacatggggacaaagatcgtactttttggagaaatgtcctctggtctgatgaaacaaaattagaactgtttggccataatgaccaccgttaactttggaggaaaaagggggatgcttgcaagcccgaagaacaccatcccaaccgtgaagcatgagggtggcagcatcatgttttgggggtgctttgctgcaggagggtctggttcactacacaaaatagatggcatcatgaggagagaaaattatgaggatatattgaagca

Function

NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU2588370 True 788 lncRNA 0.41 2 22381142 22381967
Loading

Neighbor

gene id symbol gene type direction distance location
cxcl14 cxcl14 coding downstream 301740 22074473 ~ 22079651 (-)
LOC110504785 LOC106611968 coding downstream 306725 22013480 ~ 22074417 (-)
LOC110504778 LOC106611974 coding downstream 415053 21959917 ~ 21966089 (-)
LOC110504777 sil1 coding downstream 421978 21954414 ~ 21959164 (-)
LOC110504775 csnk1a1 coding downstream 447172 21907924 ~ 21933970 (-)
LOC110504789 pde6a coding upstream 540301 22922268 ~ 22944025 (-)
LOC110504792 LOC106611950 coding upstream 812211 23194178 ~ 23196258 (-)
LOC110504794 LOC106611928 coding upstream 818907 23200874 ~ 23225284 (-)
LOC110504795 LOC106611930 coding upstream 1021104 23403071 ~ 23407881 (-)
LOC118946028 NA coding upstream 1256102 23638069 ~ 23639196 (-)
G2262854 NA non-coding downstream 37182 22342346 ~ 22343960 (-)
G2262793 NA non-coding downstream 180009 22200807 ~ 22201133 (-)
G2262779 NA non-coding downstream 205589 22174924 ~ 22175553 (-)
G2262528 NA non-coding downstream 239152 22141767 ~ 22141990 (-)
G2262517 NA non-coding downstream 254496 22124474 ~ 22126646 (-)
G2262919 NA non-coding upstream 91288 22473255 ~ 22473610 (-)
G2262927 NA non-coding upstream 122975 22504942 ~ 22505391 (-)
G2262951 NA non-coding upstream 172651 22554618 ~ 22578447 (-)
G2263012 NA non-coding upstream 254621 22636588 ~ 22637201 (-)
G2263075 NA non-coding upstream 309472 22691439 ~ 22694729 (-)
G2262514 NA other downstream 259328 22121221 ~ 22121814 (-)
G2262444 NA other downstream 373802 22006313 ~ 22007340 (-)
G2262421 NA other downstream 442331 21937881 ~ 21938811 (-)
G2262244 NA other downstream 739598 21640974 ~ 21641544 (-)
G2262186 NA other downstream 847013 21533623 ~ 21534129 (-)
G2262922 NA other upstream 104288 22486255 ~ 22486678 (-)
G2263483 NA other upstream 661459 23043426 ~ 23043896 (-)
G2263534 LOC106611927 other upstream 724479 23106446 ~ 23107806 (-)
G2264599 LOC106611931 other upstream 1295626 23677593 ~ 23711113 (-)

Expression

G2262875 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G2262875 Expression in each Bioproject

Bar chart with 21 bars.
G2262875 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network