G2262951



Basic Information


Item Value
gene id G2262951
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050571.1
NCBI id CM025858.1
chromosome length 44108611
location 22554618 ~ 22578447 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2588456
gaggagcgaggagagggacgaaagctatactgttacactggcaatactaaagtgcctataagaacatctaatagtcaaaggttaatgaaatacaaatggtatagagggaaatagtcctgtaattcctataataactacaacctaaaacttcttacctgggaatattgaagactcatgttaaaaggaaccaccagctttcatatgttctcatgttctgagcaaggaacttaaatgttagctttcttacatggcacatattgcacttttactttcttctcca

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2588456 True 280 lncRNA 0.36 2 22554618 22578447
Loading

Neighbor


gene id symbol gene type direction distance location
cxcl14 cxcl14 coding downstream 475216 22074473 ~ 22079651 (-)
LOC110504785 LOC106611968 coding downstream 480201 22013480 ~ 22074417 (-)
LOC110504778 LOC106611974 coding downstream 588529 21959917 ~ 21966089 (-)
LOC110504777 sil1 coding downstream 595454 21954414 ~ 21959164 (-)
LOC110504775 csnk1a1 coding downstream 620648 21907924 ~ 21933970 (-)
LOC110504789 pde6a coding upstream 343821 22922268 ~ 22944025 (-)
LOC110504792 LOC106611950 coding upstream 615731 23194178 ~ 23196258 (-)
LOC110504794 LOC106611928 coding upstream 622427 23200874 ~ 23225284 (-)
LOC110504795 LOC106611930 coding upstream 824624 23403071 ~ 23407881 (-)
LOC118946028 NA coding upstream 1059622 23638069 ~ 23639196 (-)
G2262927 NA non-coding downstream 49227 22504942 ~ 22505391 (-)
G2262919 NA non-coding downstream 81008 22473255 ~ 22473610 (-)
G2262875 NA non-coding downstream 172651 22381142 ~ 22381967 (-)
G2262854 NA non-coding downstream 210658 22342346 ~ 22343960 (-)
G2262793 NA non-coding downstream 353485 22200807 ~ 22201133 (-)
G2263012 NA non-coding upstream 58141 22636588 ~ 22637201 (-)
G2263075 NA non-coding upstream 112992 22691439 ~ 22694729 (-)
G2263081 NA non-coding upstream 124652 22703099 ~ 22703433 (-)
G2263109 NA non-coding upstream 164763 22743210 ~ 22745047 (-)
G2263159 NA non-coding upstream 206990 22785437 ~ 22785663 (-)
G2262922 NA other downstream 67940 22486255 ~ 22486678 (-)
G2262514 NA other downstream 432804 22121221 ~ 22121814 (-)
G2262444 NA other downstream 547278 22006313 ~ 22007340 (-)
G2262421 NA other downstream 615807 21937881 ~ 21938811 (-)
G2262244 NA other downstream 913074 21640974 ~ 21641544 (-)
G2263483 NA other upstream 464979 23043426 ~ 23043896 (-)
G2263534 LOC106611927 other upstream 527999 23106446 ~ 23107806 (-)
G2264599 LOC106611931 other upstream 1099146 23677593 ~ 23711113 (-)
LOC110504814 kiaa1191 other upstream 1756268 24334697 ~ 24357789 (-)

Expression


G2262951 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G2262951 Expression in each Bioproject

Bar chart with 18 bars.
G2262951 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network