G2264213


Basic Information

Item Value
gene id G2264213
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_050571.1
NCBI id CM025858.1
chromosome length 44108611
location 23886347 ~ 23886888 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU2589850
tcagtataaaagacacctgtccacaacctcaaacagtcacactccaaactccactatagccaagaccaaagagctgtcaaaattgtagacctgcaccaggctgggaagactgaatctgcaataggtaagcagcttggtttgaagaaatcaactgtgggagcaattattaggaaatggaagacatacaagaccactgataatctccctcgatctggggctccacgcaagatctcaccccgtggggtcaaaatgatcacaagaacggtgagcaaaaatcccagaaccacacagggggacctagtgaatgacctgcagagagctgggaccaaagtaacaaagcctaccatcagtaacacactacgccgccagggactcaaatcctgcagtgccagacgtgtccccctgcttaagccagtacatgtccaggcccgtctgaagtttgctagagagcatttggatgatccagaagaagattgggagaatgtcatatggtcagatgaaaccaaaatataactttttggtaaaaactcaactagtcgtgt

Function

NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU2589850 True 542 lncRNA 0.47 1 23886347 23886888
Loading

Neighbor

gene id symbol gene type direction distance location
LOC110504805 LOC100691570 coding upstream 43929 23836618 ~ 23842418 (+)
LOC110504797 LOC106611931 coding upstream 184559 23694188 ~ 23701788 (+)
LOC110504798 NA coding upstream 205713 23675075 ~ 23680634 (+)
htr4 LOC106611927 coding upstream 747442 23048270 ~ 23138905 (+)
LOC118946027 NA coding upstream 872057 23004053 ~ 23014290 (+)
LOC110504821 LOC106611869 coding downstream 966145 24853033 ~ 24856333 (+)
LOC110504822 LOC106611910 coding downstream 1117385 25004273 ~ 25011653 (+)
LOC110504823 LOC106604841 coding downstream 1178600 25065488 ~ 25080226 (+)
LOC110504826 LOC106611870 coding downstream 1204744 25091632 ~ 25181408 (+)
LOC100136157 LOC100136157 coding downstream 1296334 25183222 ~ 25191478 (+)
G2264209 NA non-coding upstream 6212 23879911 ~ 23880135 (+)
G2264207 NA non-coding upstream 8860 23875971 ~ 23877487 (+)
G2264205 NA non-coding upstream 13502 23872590 ~ 23872845 (+)
G2264203 NA non-coding upstream 18322 23867611 ~ 23868025 (+)
G2264113 LOC100136700 non-coding upstream 22374 23855609 ~ 23863973 (+)
G2264216 NA non-coding downstream 8454 23895342 ~ 23940695 (+)
G2264270 NA non-coding downstream 161180 24048068 ~ 24055009 (+)
G2264293 NA non-coding downstream 207357 24094245 ~ 24094492 (+)
G2264292 NA non-coding downstream 249110 24135998 ~ 24187680 (+)
G2264332 NA non-coding downstream 285033 24171921 ~ 24173188 (+)
G2264210 LOC106582338 other upstream 5315 23880781 ~ 23881032 (+)
G2264115 NA other upstream 175261 23697688 ~ 23711086 (+)
G2263926 NA other upstream 360327 23525340 ~ 23526020 (+)
G2262601 NA other upstream 1612640 22269718 ~ 22273707 (+)
G2264344 NA other downstream 303185 24190073 ~ 24190352 (+)
G2264345 NA other downstream 303862 24190750 ~ 24191035 (+)
G2265425 LOC106611874 other downstream 1328763 25215651 ~ 25244329 (+)
si:dkey-74k8.4 aldob other downstream 1695105 25557578 ~ 25586728 (+)
G2265625 NA other downstream 1738257 25625145 ~ 25626856 (+)

Expression

G2264213 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 250.
End of interactive chart.

G2264213 Expression in each Bioproject

Bar chart with 21 bars.
G2264213 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 6000.
End of interactive chart.

Co-expression Network