G2265758



Basic Information


Item Value
gene id G2265758
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050571.1
NCBI id CM025858.1
chromosome length 44108611
location 26028321 ~ 26029603 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2591686
ACCATACTGGATGGGATGGTAGAAGAAAGTAACCATACTGGATGGGATGGTAGAAGAAAGTAACGATACTGGATGGGATGGTAGAAGAAAGTAACCCTACTGGATGGGATGGTAGAAGAAAGTAACCATACTGGATGGGATGGTAGAAGAAAGTAACCATACTGGATGGGATGGTAGAAGAGAGTAACCATACTGGATGGGATGGTAGAAGAAAGTAACCATACTGGATGGGATGGTAGAAGAGAGGAACCATACTGGATGGGATGGTAGAAGAAAGTAACCATACTGGATGGGATGGTAGAAGAAAGACACCATACTGGAT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2591686 True 322 lncRNA 0.43 2 26028321 26029603
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110504854 LOC106611908 coding upstream 97717 25880623 ~ 25930604 (+)
LOC110504852 LOC106611898 coding upstream 189824 25820435 ~ 25838497 (+)
LOC110504413 LOC106611901 coding upstream 208311 25756889 ~ 25820010 (+)
LOC118946029 NA coding upstream 283807 25741463 ~ 25744514 (+)
LOC118946024 LOC106611902 coding upstream 319117 25703755 ~ 25709204 (+)
LOC110504418 LOC106604872 coding downstream 183406 26213009 ~ 26276405 (+)
LOC118946064 NA coding downstream 261278 26289725 ~ 26292004 (+)
LOC110504416 diaph1 coding downstream 269172 26298775 ~ 26483992 (+)
LOC110504898 LOC106611819 coding downstream 1096017 27125620 ~ 27174120 (+)
LOC110504902 k0141 coding downstream 1670086 27699689 ~ 27711246 (+)
G2265746 NA non-coding upstream 43426 25982588 ~ 25984895 (+)
G2265743 NA non-coding upstream 50225 25977885 ~ 25978096 (+)
G2265731 NA non-coding upstream 76360 25951652 ~ 25951961 (+)
G2265700 NA non-coding upstream 191947 25835921 ~ 25836374 (+)
G2265698 NA non-coding upstream 203592 25824371 ~ 25824729 (+)
G2265766 NA non-coding downstream 9818 26039421 ~ 26039783 (+)
G2265775 NA non-coding downstream 32331 26061934 ~ 26071365 (+)
G2265778 NA non-coding downstream 33454 26063057 ~ 26113361 (+)
G2265794 NA non-coding downstream 69282 26098885 ~ 26099561 (+)
G2265802 NA non-coding downstream 92994 26122597 ~ 26122929 (+)
G2265744 NA other upstream 49683 25978135 ~ 25978638 (+)
G2265625 NA other upstream 401465 25625145 ~ 25626856 (+)
si:dkey-74k8.4 aldob other upstream 442254 25557578 ~ 25586728 (+)
G2265425 LOC106611874 other upstream 783992 25215651 ~ 25244329 (+)
G2266668 LOC106611853 other downstream 561663 26588592 ~ 26620948 (+)
G2266826 NA other downstream 905117 26934720 ~ 26935889 (+)
G2268340 NA other downstream 2737274 28766877 ~ 28767729 (+)

Expression


G2265758 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G2265758 Expression in each Bioproject

Bar chart with 17 bars.
G2265758 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network