G2269030



Basic Information


Item Value
gene id G2269030
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050571.1
NCBI id CM025858.1
chromosome length 44108611
location 28094148 ~ 28094356 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2595627
gcagcgccagctgtgccatcagagactctgggttcgcgcccaggctctgtcgtaaccagccgcgaccggaaggtctgtggggcgacgcacaattggcctagcgttgtccgggttagggagggcttggctggtagggatgtccttgtctcattgcgcaccagtgactcctgtggcgggccgggcgcagtgtgcgctaaccaaggttgcca

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2595627 True 209 lncRNA 0.64 1 28094148 28094356
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110504918 LOC106611703 coding downstream 3696 28066159 ~ 28090452 (-)
LOC110504917 LOC106611701 coding downstream 49489 28029948 ~ 28044659 (-)
LOC110504437 vpp3 coding downstream 69879 28011845 ~ 28024269 (-)
LOC110504915 NA coding downstream 82515 28007363 ~ 28011633 (-)
LOC110504913 LOC106611699 coding downstream 109182 27961895 ~ 27984966 (-)
LOC110504921 LOC106611706 coding upstream 4627 28098983 ~ 28127992 (-)
LOC110504922 LOC103372938 coding upstream 37551 28131907 ~ 28134879 (-)
LOC110504923 aup1 coding upstream 43289 28137645 ~ 28153024 (-)
srpx2 srpx2 coding upstream 93401 28187757 ~ 28198633 (-)
LOC110504930 LOC106611712 coding upstream 234587 28328943 ~ 28358459 (-)
G2269010 NA non-coding downstream 36916 28057030 ~ 28057232 (-)
G2269008 NA non-coding downstream 38948 28054871 ~ 28055200 (-)
G2269006 NA non-coding downstream 40486 28053340 ~ 28053662 (-)
G2268945 NA non-coding downstream 72106 28021578 ~ 28022042 (-)
G2269028 NA non-coding upstream 413 28094769 ~ 28094987 (-)
G2269048 NA non-coding upstream 74169 28168525 ~ 28168753 (-)
G2269051 NA non-coding upstream 114460 28208816 ~ 28209720 (-)
G2269063 NA non-coding upstream 115560 28209916 ~ 28210154 (-)
G2269064 NA non-coding upstream 119988 28214344 ~ 28215020 (-)
G2269004 NA other downstream 41461 28051204 ~ 28052687 (-)
LOC118946021 LOC106611696 other downstream 141564 27828431 ~ 27952655 (-)
LOC118946063 NA other downstream 590804 27481197 ~ 27503675 (-)
G2267521 LOC107579696 other downstream 984160 27109540 ~ 27109988 (-)
LOC110504893 LOC106590882 other downstream 1072068 27008474 ~ 27028053 (-)
G2269277 NA other upstream 512044 28606400 ~ 28606788 (-)
G2269291 NA other upstream 540574 28634930 ~ 28635299 (-)
G2270186 NA other upstream 1976022 30070378 ~ 30072129 (-)
G2270673 LOC106611749 other upstream 2189377 30283733 ~ 30319917 (-)

Expression


G2269030 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G2269030 Expression in each Bioproject

Bar chart with 16 bars.
G2269030 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network