G2268058



Basic Information


Item Value
gene id G2268058
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050571.1
NCBI id CM025858.1
chromosome length 44108611
location 28168234 ~ 28168601 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2594567
cgcttggggtatgtctatcagttttgcacatcgagagactgaaattttttcccattcctccttgcaaaacagctcgagctcagtgaggttggatggagagcatttgtgaacagcagttttcagttctttccacagattctcgattggattcaggtctggactttgacttggccattctaacacctggatgtttatttttgaaccattccattgtagattttgctttatgttttggatcattgtcttgttggaagacaaatctccgtcccagtctcaggtcttttgcagactccatcaggttttcttccagactggtcctgtatttggctccatccatcttcccatcaattttaaccatcttccctgtc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2594567 True 368 lncRNA 0.43 1 28168234 28168601
Loading

Neighbor


gene id symbol gene type direction distance location
trmt12 LOC106611794 coding upstream 4321 28155421 ~ 28163913 (+)
LOC110504919 LOC106611705 coding upstream 102507 28057412 ~ 28065727 (+)
LOC118946038 NA coding upstream 111809 28054388 ~ 28056425 (+)
LOC110504914 LOC106611700 coding upstream 157912 27987952 ~ 28010322 (+)
LOC110504912 LOC106611698 coding upstream 206415 27958738 ~ 27961819 (+)
sytl4 LOC106611707 coding downstream 1860 28170461 ~ 28188340 (+)
LOC110504926 tsn7 coding downstream 30072 28198673 ~ 28209723 (+)
LOC110504927 NA coding downstream 56836 28225437 ~ 28244563 (+)
LOC110504299 NA coding downstream 87845 28256446 ~ 28307408 (+)
m1ip1 m1ip1 coding downstream 133803 28302404 ~ 28304890 (+)
G2268038 NA non-coding upstream 31510 28136520 ~ 28136724 (+)
G2268037 NA non-coding upstream 31793 28136160 ~ 28136441 (+)
G2268036 NA non-coding upstream 32347 28135541 ~ 28135887 (+)
G2268035 LOC106611706 non-coding upstream 40681 28126741 ~ 28127553 (+)
G2267999 LOC106611703 non-coding upstream 90206 28073526 ~ 28078028 (+)
G2268059 NA non-coding downstream 407 28169008 ~ 28169512 (+)
G2268060 NA non-coding downstream 1137 28169738 ~ 28170065 (+)
G2268078 NA non-coding downstream 45033 28213634 ~ 28214329 (+)
G2268088 NA non-coding downstream 51042 28219643 ~ 28219948 (+)
G2268103 NA non-coding downstream 112570 28281171 ~ 28285957 (+)
G2266826 NA other upstream 1232345 26934720 ~ 26935889 (+)
G2266668 LOC106611853 other upstream 1547286 26588592 ~ 26620948 (+)
LOC110504416 diaph1 other upstream 1795751 26298775 ~ 26483992 (+)
LOC118946064 NA other upstream 1876230 26289725 ~ 26292004 (+)
G2265744 NA other upstream 2189596 25978135 ~ 25978638 (+)
G2268340 NA other downstream 598276 28766877 ~ 28767729 (+)
G2268400 LOC106611722 other downstream 728154 28896755 ~ 28898079 (+)
G2271027 NA other downstream 3008289 31176890 ~ 31181107 (+)
G2272912 LOC106611792 other downstream 4694835 32863436 ~ 32866226 (+)
LOC110505056 LOC105028844 other downstream 5247489 33328263 ~ 33421963 (+)

Expression


G2268058 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G2268058 Expression in each Bioproject

Bar chart with 19 bars.
G2268058 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network