G2268059


Basic Information

Item Value
gene id G2268059
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_050571.1
NCBI id CM025858.1
chromosome length 44108611
location 28169008 ~ 28169512 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU2594568
gtttagagggacggccaggtcttggtagatttgcagtggtctgatactccttccatttcaatattatcgcttgcacagtgctccttgggatgtttaaagcttgggaaatctttttgtatccaaatccagctttaaacttcttcacaacagtatctcggacctgcctggtgtgttccttgttcttcatgatgctctctgcgcttttaacggacctctgagactatcacagtgcaggtgcatttatacggagacttgattacacacaggtggattgtatttatcatcattagtcatttaggtcaacgttggatcattcagagatcctcactgaacttctggagagagtttgctgcactgaaagtaaaggggctgaataattttgcacacccaatttttcagtttttgatttgttaaaaaagtttgaaatatccaataaatgtcgttccacttcatgattgtgtcccacttgttgttgattcttcacaaaaaaatacagttttatatc

Function

NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU2594568 True 505 lncRNA 0.39 1 28169008 28169512
Loading

Neighbor

gene id symbol gene type direction distance location
trmt12 LOC106611794 coding upstream 5095 28155421 ~ 28163913 (+)
LOC110504919 LOC106611705 coding upstream 103281 28057412 ~ 28065727 (+)
LOC118946038 NA coding upstream 112583 28054388 ~ 28056425 (+)
LOC110504914 LOC106611700 coding upstream 158686 27987952 ~ 28010322 (+)
LOC110504912 LOC106611698 coding upstream 207189 27958738 ~ 27961819 (+)
sytl4 LOC106611707 coding downstream 949 28170461 ~ 28188340 (+)
LOC110504926 tsn7 coding downstream 29161 28198673 ~ 28209723 (+)
LOC110504927 NA coding downstream 55925 28225437 ~ 28244563 (+)
LOC110504299 NA coding downstream 86934 28256446 ~ 28307408 (+)
m1ip1 m1ip1 coding downstream 132892 28302404 ~ 28304890 (+)
G2268058 NA non-coding upstream 407 28168234 ~ 28168601 (+)
G2268038 NA non-coding upstream 32284 28136520 ~ 28136724 (+)
G2268037 NA non-coding upstream 32567 28136160 ~ 28136441 (+)
G2268036 NA non-coding upstream 33121 28135541 ~ 28135887 (+)
G2268035 LOC106611706 non-coding upstream 41455 28126741 ~ 28127553 (+)
G2268060 NA non-coding downstream 226 28169738 ~ 28170065 (+)
G2268078 NA non-coding downstream 44122 28213634 ~ 28214329 (+)
G2268088 NA non-coding downstream 50131 28219643 ~ 28219948 (+)
G2268103 NA non-coding downstream 111659 28281171 ~ 28285957 (+)
G2268083 NA non-coding downstream 126661 28296173 ~ 28299867 (+)
G2266826 NA other upstream 1233119 26934720 ~ 26935889 (+)
G2266668 LOC106611853 other upstream 1548060 26588592 ~ 26620948 (+)
LOC110504416 diaph1 other upstream 1796525 26298775 ~ 26483992 (+)
LOC118946064 NA other upstream 1877004 26289725 ~ 26292004 (+)
G2265744 NA other upstream 2190370 25978135 ~ 25978638 (+)
G2268340 NA other downstream 597365 28766877 ~ 28767729 (+)
G2268400 LOC106611722 other downstream 727243 28896755 ~ 28898079 (+)
G2271027 NA other downstream 3007378 31176890 ~ 31181107 (+)
G2272912 LOC106611792 other downstream 4693924 32863436 ~ 32866226 (+)
LOC110505056 LOC105028844 other downstream 5246578 33328263 ~ 33421963 (+)

Expression

G2268059 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G2268059 Expression in each Bioproject

Bar chart with 16 bars.
G2268059 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network