G2268088



Basic Information


Item Value
gene id G2268088
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050571.1
NCBI id CM025858.1
chromosome length 44108611
location 28219643 ~ 28219948 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2594598
ATGAATGCAGGGACGAGACCACCAGCCAATCCTAAATATGCATTATAAACTAGAGAGACTTGTGTTGTATTTCTCCAGTCATTTGCTTGGCCTGGAGGTCATGTTTCATCCATAGTAGAGATGGTACGCCTGAGTACCTGTTCTCTTGTTGTCAGCACTTCGTCCGCATTCCTGGTGATGTAGAATTTACAAGAAATGCAGTCATGAAATGACTCCTTCATTTGAAGGAGGATCTCATTTTTTACACTCCAGCTCATGTGATGTCGCCGGAACAGTATTTGATTGATTCTAAGTTGACTCACTTTT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2594598 True 306 lncRNA 0.42 1 28219643 28219948
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110504926 tsn7 coding upstream 9920 28198673 ~ 28209723 (+)
sytl4 LOC106611707 coding upstream 31303 28170461 ~ 28188340 (+)
trmt12 LOC106611794 coding upstream 55730 28155421 ~ 28163913 (+)
LOC110504919 LOC106611705 coding upstream 153916 28057412 ~ 28065727 (+)
LOC118946038 NA coding upstream 163218 28054388 ~ 28056425 (+)
LOC110504927 NA coding downstream 5489 28225437 ~ 28244563 (+)
LOC110504299 NA coding downstream 36498 28256446 ~ 28307408 (+)
m1ip1 m1ip1 coding downstream 82456 28302404 ~ 28304890 (+)
trnav-uac-98 NA coding downstream 133669 28353617 ~ 28353689 (+)
LOC110504931 LOC106611711 coding downstream 138744 28358692 ~ 28370507 (+)
G2268078 NA non-coding upstream 5314 28213634 ~ 28214329 (+)
G2268060 NA non-coding upstream 49578 28169738 ~ 28170065 (+)
G2268059 NA non-coding upstream 50131 28169008 ~ 28169512 (+)
G2268058 NA non-coding upstream 51042 28168234 ~ 28168601 (+)
G2268038 NA non-coding upstream 82919 28136520 ~ 28136724 (+)
G2268103 NA non-coding downstream 61223 28281171 ~ 28285957 (+)
G2268083 NA non-coding downstream 76225 28296173 ~ 28299867 (+)
G2268132 NA non-coding downstream 131249 28351197 ~ 28351400 (+)
G2268133 NA non-coding downstream 131870 28351818 ~ 28352373 (+)
G2268147 NA non-coding downstream 169044 28388992 ~ 28389324 (+)
G2266826 NA other upstream 1283754 26934720 ~ 26935889 (+)
G2266668 LOC106611853 other upstream 1598695 26588592 ~ 26620948 (+)
LOC110504416 diaph1 other upstream 1847160 26298775 ~ 26483992 (+)
LOC118946064 NA other upstream 1927639 26289725 ~ 26292004 (+)
G2265744 NA other upstream 2241005 25978135 ~ 25978638 (+)
G2268340 NA other downstream 546929 28766877 ~ 28767729 (+)
G2268400 LOC106611722 other downstream 676807 28896755 ~ 28898079 (+)
G2271027 NA other downstream 2956942 31176890 ~ 31181107 (+)
G2272912 LOC106611792 other downstream 4643488 32863436 ~ 32866226 (+)
LOC110505056 LOC105028844 other downstream 5196142 33328263 ~ 33421963 (+)

Expression


G2268088 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G2268088 Expression in each Bioproject

Bar chart with 11 bars.
G2268088 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network