G2268147



Basic Information


Item Value
gene id G2268147
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050571.1
NCBI id CM025858.1
chromosome length 44108611
location 28388992 ~ 28389324 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2594662
GTAAATCTGCTACTCTAGAGGAATCTGGAGGGATATGACACAGGTCACTGCTTCCACATCCGTCAGAGGCTCCGCTAGAAATTTGAATACTTGACACAGTGGTTTCTTCCACACATGGCTGATAGTCACACTTCACTAAATGGATCACATTCACCTCACAGATTCAAGGCAGTTCCTTGATGTGGAAAATATTCAATGCAGAACGACAATAATGAATTATAGGAAACACTATTATTCTACTTTTCTGGGTCTTTTGTTATCTGTAATGTTATCCATTGTACACCATATGGAATGGTAAGTCACGCAGAGCTAAAGACAACATGCCAAAGGCCT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2594662 True 333 lncRNA 0.41 1 28388992 28389324

Neighbor


gene id symbol gene type direction distance location
LOC110504931 LOC106611711 coding upstream 18485 28358692 ~ 28370507 (+)
trnav-uac-98 NA coding upstream 35303 28353617 ~ 28353689 (+)
LOC110504299 NA coding upstream 81584 28256446 ~ 28307408 (+)
m1ip1 m1ip1 coding upstream 84102 28302404 ~ 28304890 (+)
LOC110504927 NA coding upstream 144429 28225437 ~ 28244563 (+)
LOC110504300 NA coding downstream 12925 28402249 ~ 28404199 (+)
LOC110504934 LOC106611715 coding downstream 17694 28407018 ~ 28409839 (+)
LOC110504935 LOC106611716 coding downstream 20987 28410311 ~ 28425659 (+)
LOC110504439 LOC106611717 coding downstream 46760 28436084 ~ 28664707 (+)
LOC110504936 LOC106611718 coding downstream 315079 28704403 ~ 28722745 (+)
G2268133 NA non-coding upstream 36619 28351818 ~ 28352373 (+)
G2268132 NA non-coding upstream 37592 28351197 ~ 28351400 (+)
G2268083 NA non-coding upstream 89125 28296173 ~ 28299867 (+)
G2268103 NA non-coding upstream 103035 28281171 ~ 28285957 (+)
G2268088 NA non-coding upstream 169044 28219643 ~ 28219948 (+)
G2268151 NA non-coding downstream 5074 28394398 ~ 28394676 (+)
G2268152 NA non-coding downstream 5431 28394755 ~ 28394961 (+)
G2268153 NA non-coding downstream 6644 28395968 ~ 28396232 (+)
G2268160 NA non-coding downstream 13081 28402405 ~ 28402690 (+)
G2268211 NA non-coding downstream 109241 28498565 ~ 28498838 (+)
G2266826 NA other upstream 1453103 26934720 ~ 26935889 (+)
G2266668 LOC106611853 other upstream 1768044 26588592 ~ 26620948 (+)
LOC110504416 diaph1 other upstream 2016509 26298775 ~ 26483992 (+)
LOC118946064 NA other upstream 2096988 26289725 ~ 26292004 (+)
G2265744 NA other upstream 2410354 25978135 ~ 25978638 (+)
G2268340 NA other downstream 377553 28766877 ~ 28767729 (+)
G2268400 LOC106611722 other downstream 507431 28896755 ~ 28898079 (+)
G2271027 NA other downstream 2787566 31176890 ~ 31181107 (+)
G2272912 LOC106611792 other downstream 4474112 32863436 ~ 32866226 (+)
LOC110505056 LOC105028844 other downstream 5026766 33328263 ~ 33421963 (+)

Expression


G2268147 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.6.
End of interactive chart.

G2268147 Expression in each Bioproject

Bar chart with 6 bars.
G2268147 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 5.
End of interactive chart.

Co-expression Network