G2269277



Basic Information


Item Value
gene id G2269277
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050571.1
NCBI id CM025858.1
chromosome length 44108611
location 28606400 ~ 28606788 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2595893
cctgcactgtgatagtctcagaggtccgttaaaagcgcagagagcatcatgaagaacaaggaacacaccaggcaggtccgagatactgttgtgaagaagtttaaagccggatttggatacaaaaagatttcccaagctttaaacatcccaaggagcactgtgcaagcgataatattgaaatggaaggagtatcagaccactgcaaatctaccaagacctggccgtccctctaaactttcagctcatacaaggagaagactgatcagagatgcagccaagaggcccatgatcactctggatgaaatgcagagatctacagctgaggtgggagactctgtccataggacaacaatcagtcgtatattgcacaaatctggcctttatggaag

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2595893 True 389 TUCP 0.46 1 28606400 28606788
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110504933 LOC106611714 coding downstream 214275 28384451 ~ 28392125 (-)
LOC110504932 LOC106611713 coding downstream 225243 28370506 ~ 28381157 (-)
LOC110504930 LOC106611712 coding downstream 247941 28328943 ~ 28358459 (-)
srpx2 srpx2 coding downstream 407767 28187757 ~ 28198633 (-)
LOC110504923 aup1 coding downstream 453376 28137645 ~ 28153024 (-)
LOC100305219 taf7 coding upstream 82503 28689291 ~ 28702826 (-)
LOC110504938 LOC106611719 coding upstream 141521 28748309 ~ 28803449 (-)
LOC110504441 LOC106611722 coding upstream 283395 28890183 ~ 28919876 (-)
LOC118946017 NA coding upstream 286559 28893347 ~ 28893981 (-)
LOC110504944 LOC106611724 coding upstream 313511 28920299 ~ 28926005 (-)
G2269267 NA non-coding downstream 19351 28586840 ~ 28587049 (-)
G2269256 NA non-coding downstream 36955 28569245 ~ 28569445 (-)
G2269245 NA non-coding downstream 52937 28553208 ~ 28553463 (-)
G2269242 NA non-coding downstream 58505 28547592 ~ 28547895 (-)
G2269241 NA non-coding downstream 59416 28546655 ~ 28546984 (-)
G2269278 NA non-coding upstream 12 28606800 ~ 28607008 (-)
G2269283 NA non-coding upstream 9723 28616511 ~ 28616979 (-)
G2269286 NA non-coding upstream 20250 28627038 ~ 28627437 (-)
G2269289 NA non-coding upstream 25909 28632697 ~ 28632969 (-)
G2269290 NA non-coding upstream 27267 28634055 ~ 28634267 (-)
G2269004 NA other downstream 553713 28051204 ~ 28052687 (-)
LOC118946021 LOC106611696 other downstream 653816 27828431 ~ 27952655 (-)
LOC118946063 NA other downstream 1103056 27481197 ~ 27503675 (-)
G2267521 LOC107579696 other downstream 1496412 27109540 ~ 27109988 (-)
G2269291 NA other upstream 28142 28634930 ~ 28635299 (-)
G2270186 NA other upstream 1463590 30070378 ~ 30072129 (-)
G2270673 LOC106611749 other upstream 1676945 30283733 ~ 30319917 (-)
LOC110504988 LOC106515624 other upstream 1961581 30566629 ~ 30575299 (-)
LOC110505004 LOC102314576 other upstream 2565460 31172148 ~ 31175109 (-)

Expression


G2269277 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G2269277 Expression in each Bioproject

Bar chart with 19 bars.
G2269277 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network