G2270954



Basic Information


Item Value
gene id G2270954
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050571.1
NCBI id CM025858.1
chromosome length 44108611
location 31007980 ~ 31008438 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2597714
gtgaagcgtgaggtaatacagtagggggagtgcgagtgcttcttaaatgtattgctttatgcattctcctcactctcgtccacacaaaaacgtactcaagagaacggagtggagaatacaatcggagcatgagtgtggagcatggtagtatgtttggaaaaacacccctagagtttgagagttacaagcccccactcacccagtaatttttgaactgtccctaaattatcctattaaaacactacatgggaaatacgtcatgaactcacaacaattgaaagtgcagagtataaaacagtacttagcctaatatattatgaacagccacgatagcgtcgtctactggtaggtctattttgaatcaatatttcaactcgccaccacactctaccttccactggtgtttcccaactgcagtcctcaggttgccccagcaacacacattcacattttagagcc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2597714 True 459 lncRNA 0.43 1 31007980 31008438
Loading

Neighbor


gene id symbol gene type direction distance location
rap2c rap2c coding downstream 356553 30647146 ~ 30651427 (-)
zgc:92907 alg13 coding downstream 360989 30643575 ~ 30646991 (-)
LOC110504991 LOC106611768 coding downstream 384427 30612746 ~ 30623553 (-)
LOC110504993 LOC106611766 coding downstream 409118 30592218 ~ 30598862 (-)
LOC110504989 LOC106611764 coding downstream 415907 30579004 ~ 30592073 (-)
LOC110504996 LOC106611770 coding upstream 65504 31073942 ~ 31092414 (-)
hars LOC106611772 coding upstream 109663 31118101 ~ 31122831 (-)
LOC110505004 LOC102314576 coding upstream 163710 31172148 ~ 31175109 (-)
LOC110505008 LOC106611777 coding upstream 174787 31183225 ~ 31186186 (-)
LOC110505005 naa15 coding upstream 185264 31193702 ~ 31206251 (-)
G2270953 NA non-coding downstream 3481 31004166 ~ 31004499 (-)
G2270949 NA non-coding downstream 6138 31001515 ~ 31001842 (-)
G2270927 NA non-coding downstream 30598 30977158 ~ 30977382 (-)
G2270919 NA non-coding downstream 54650 30952914 ~ 30953330 (-)
G2270918 NA non-coding downstream 55511 30952178 ~ 30952469 (-)
G2270960 NA non-coding upstream 4096 31012534 ~ 31012745 (-)
G2270961 NA non-coding upstream 4641 31013079 ~ 31013290 (-)
G2271105 NA non-coding upstream 15393 31023831 ~ 31024103 (-)
G2271107 NA non-coding upstream 16590 31025028 ~ 31025250 (-)
G2271108 NA non-coding upstream 17211 31025649 ~ 31025928 (-)
LOC110504988 LOC106515624 other downstream 432710 30566629 ~ 30575299 (-)
G2270673 LOC106611749 other downstream 688063 30283733 ~ 30319917 (-)
G2270186 NA other downstream 935851 30070378 ~ 30072129 (-)
G2269291 NA other downstream 2372681 28634930 ~ 28635299 (-)
G2269277 NA other downstream 2401192 28606400 ~ 28606788 (-)
G2272324 NA other upstream 1244945 32253383 ~ 32253938 (-)
LOC110505054 LOC106611652 other upstream 2303478 33308270 ~ 33313952 (-)
LOC110505064 LOC106611642 other upstream 2690147 33693783 ~ 33765421 (-)
LOC110505071 LOC106611637 other upstream 3058257 34008192 ~ 34106811 (-)

Expression


G2270954 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G2270954 Expression in each Bioproject

Bar chart with 15 bars.
G2270954 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network