trnap-agg-165



Basic Information


Item Value
gene id trnap-agg-165
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050572.1
NCBI id CM025859.1
chromosome length 41837469
location 9363049 ~ 9363120 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>trnap-agg-165
ggctcgttggtctaggggtatgattctcgcttagggtgcgagaggtcccgggttcaaatcccggacgagccc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
trnap-agg-165 True 72 mRNA 0.61 1 9363049 9363120

Neighbor


gene id symbol gene type direction distance location
trnap-agg-163 NA coding upstream 5887 9357091 ~ 9357162 (+)
trnap-agg-161 NA coding upstream 9161 9353817 ~ 9353888 (+)
LOC118946539 NA coding upstream 38047 9324340 ~ 9325002 (+)
LOC110489366 LOC105012323 coding upstream 200553 9046596 ~ 9162941 (+)
LOC110487879 LOC106570673 coding upstream 343580 9005647 ~ 9019469 (+)
trnap-agg-167 NA coding downstream 3203 9366323 ~ 9366394 (+)
trnap-agg-170 NA coding downstream 12425 9375545 ~ 9375616 (+)
trnap-agg-172 NA coding downstream 15772 9378892 ~ 9379108 (+)
LOC110487882 LOC106570647 coding downstream 19607 9382727 ~ 9386344 (+)
LOC110487883 LOC106570652 coding downstream 47193 9410313 ~ 9429688 (+)
G2294458 NA non-coding upstream 15735 9346818 ~ 9347314 (+)
G2294457 NA non-coding upstream 17971 9344761 ~ 9345078 (+)
G2294449 NA non-coding upstream 32341 9330259 ~ 9330708 (+)
G2294448 NA non-coding upstream 34395 9327450 ~ 9328654 (+)
G2294421 NA non-coding upstream 94997 9266756 ~ 9268052 (+)
G2294462 NA non-coding downstream 17734 9380854 ~ 9381293 (+)
G2294472 NA non-coding downstream 46722 9409842 ~ 9410070 (+)
G2294440 NA non-coding downstream 70928 9434048 ~ 9435450 (+)
G2294479 NA non-coding downstream 73326 9436446 ~ 9436764 (+)
G2294452 LOC106570648 other upstream 25294 9335335 ~ 9337755 (+)
G2294081 NA other upstream 259863 9094792 ~ 9103186 (+)
G2293943 LOC106570655 other upstream 515797 8844013 ~ 8847252 (+)
G2293942 NA other upstream 567547 8791101 ~ 8876464 (+)
G2293829 NA other upstream 851308 8510872 ~ 8511770 (+)
G2294925 NA other downstream 766996 10130116 ~ 10131651 (+)
LOC118946540 NA other downstream 955732 10318805 ~ 10323588 (+)
LOC110487904 snrpd1 other downstream 1151834 10509464 ~ 10521398 (+)
G2296150 LOC106570575 other downstream 1922373 11285493 ~ 11290303 (+)
G2296278 NA other downstream 2200427 11563547 ~ 11564590 (+)

Expression


trnap-agg-165 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network