LOC118946559



Basic Information


Item Value
gene id LOC118946559
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050572.1
NCBI id CM025859.1
chromosome length 41837469
location 25457021 ~ 25457101 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>XR_005041430.1
TCTGGCTGTAATGACACTTGCCCTCACTGAGAGGAGTGCCTCGATAATGAGAACACCGTAGTACTCAACTTCTGAGCCATG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
XR_005041430.1 True 81 mRNA 0.49 1 25457021 25457101
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118946555 NA coding downstream 766 25456183 ~ 25456255 (-)
LOC110488168 cite2 coding downstream 78323 25371597 ~ 25378698 (-)
LOC110488163 LOC106570274 coding downstream 361126 25084011 ~ 25095895 (-)
LOC110488159 LOC106570282 coding downstream 406584 24968846 ~ 25050437 (-)
LOC110488161 ube2e1 coding downstream 490080 24952147 ~ 24966941 (-)
LOC118946558 NA coding upstream 419 25457520 ~ 25457596 (-)
LOC118946560 NA coding upstream 690 25457791 ~ 25457927 (-)
LOC110488174 LOC106588632 coding upstream 71016 25528117 ~ 25529151 (-)
LOC110488175 LOC106570260 coding upstream 538477 25995578 ~ 26002997 (-)
LOC110488176 LOC106570259 coding upstream 562219 26019320 ~ 26043739 (-)
G2311206 NA non-coding downstream 188314 25268502 ~ 25268707 (-)
G2311191 NA non-coding downstream 203092 25253703 ~ 25253929 (-)
G2311189 NA non-coding downstream 204647 25252168 ~ 25252374 (-)
G2311188 NA non-coding downstream 206045 25250752 ~ 25250976 (-)
G2311185 NA non-coding downstream 208147 25248584 ~ 25248874 (-)
G2311874 NA non-coding upstream 385442 25842543 ~ 25842806 (-)
G2311883 NA non-coding upstream 390688 25847789 ~ 25847993 (-)
G2311929 NA non-coding upstream 402444 25859545 ~ 25859787 (-)
G2311930 NA non-coding upstream 403537 25860638 ~ 25860905 (-)
G2311939 NA non-coding upstream 415283 25872384 ~ 25872794 (-)
G2311141 NA other downstream 293891 25162692 ~ 25163130 (-)
umad1 LOC106588684 other downstream 1477768 23962314 ~ 23979279 (-)
G2310415 NA other downstream 1639015 23816297 ~ 23818006 (-)
G2310381 LOC106570311 other downstream 1695670 23760515 ~ 23761351 (-)
LOC118946453 NA other downstream 2472887 22979779 ~ 22984566 (-)
G2312079 LOC106582599 other upstream 511882 25968983 ~ 25969361 (-)
G2313729 NA other upstream 1067143 26524244 ~ 26524609 (-)
LOC110488229 LOC106570201 other upstream 3837155 29283078 ~ 29318812 (-)
G2316235 NA other upstream 4040829 29497930 ~ 29500245 (-)
G2316696 NA other upstream 4577197 30034298 ~ 30039597 (-)

Expression


LOC118946559 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

LOC118946559 Expression in each Bioproject

Bar chart with 2 bars.
LOC118946559 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network