LOC118946528



Basic Information


Item Value
gene id LOC118946528
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050572.1
NCBI id CM025859.1
chromosome length 41837469
location 30077150 ~ 30077764 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>XM_036971699.1
acaacttcagcacctacgacaaccacaacaacagcacctacaacaactgtagctgccacgacaactgcagctcctgcaacagtattagcatctacgacaaccactgcagccctaacaacaacaactgctgctcctacgaccactacagctccagaacctattacgacaaccactgcagccctaacaacaacaactgctgctcctacgagcactacagctccagaacctattacgacaaccactgcagctcctgcttcaacaactacaacaactacaacttcagcacctacgacaaccacaacaacagcacctccaacaactgtagctcccacgataactgcagctcctacaacagctttagcatctacaacaaccactgcagccctaactacaacaactgctgctgctacgtccactgtaactccacaacctactacggcaaccagtgcagctcctactacaacaactgctgttctaacgaccacagtgactgcagcacctgctacaataactacaacttcagcacctacgacaaccacaacaacagcacctacaacaactgtagttgccacgacaactgcagctcctgcaacagcattagcatctacgacaacc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
XM_036971699.1 True 615 mRNA 0.49 1 30077150 30077764
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118946498 NA coding upstream 45091 30031607 ~ 30032059 (+)
LOC118946465 NA coding upstream 49493 30022055 ~ 30027657 (+)
LOC110488250 NA coding upstream 285589 29790669 ~ 29791561 (+)
LOC110489422 dus3l coding upstream 331565 29730204 ~ 29745585 (+)
LOC110488243 ifi44 coding upstream 396955 29672909 ~ 29680195 (+)
LOC118946499 NA coding downstream 21937 30099701 ~ 30100390 (+)
LOC110489425 LOC106569855 coding downstream 30452 29817983 ~ 30125310 (+)
LOC110488251 LOC106570151 coding downstream 100860 30178624 ~ 30183914 (+)
LOC110488252 LOC106569863 coding downstream 113711 30191475 ~ 30224642 (+)
LOC110488253 LOC106569864 coding downstream 431549 30509313 ~ 30544994 (+)
G2316479 NA non-coding upstream 8189 30064890 ~ 30068961 (+)
G2316478 NA non-coding upstream 22100 30052060 ~ 30055050 (+)
G2316422 NA non-coding upstream 79841 29934770 ~ 29997309 (+)
G2316423 NA non-coding upstream 129436 29945567 ~ 29947714 (+)
G2316421 NA non-coding upstream 145670 29922384 ~ 29931480 (+)
G2316748 NA non-coding downstream 65063 30142827 ~ 30143131 (+)
G2316752 NA non-coding downstream 65837 30143601 ~ 30143938 (+)
G2316904 NA non-coding downstream 171531 30249295 ~ 30249553 (+)
G2316909 NA non-coding downstream 175081 30252845 ~ 30253189 (+)
G2317052 NA non-coding downstream 286781 30364545 ~ 30364852 (+)
G2314987 NA other upstream 1373726 28698740 ~ 28703424 (+)
G2314887 NA other upstream 1513555 28520255 ~ 28563595 (+)
kcng2 LOC106570224 other upstream 2029816 28016566 ~ 28047334 (+)
G2313197 NA other upstream 2583415 27493099 ~ 27493735 (+)
tmem79a LOC106569868 other downstream 740264 30817937 ~ 30822555 (+)
G2317455 NA other downstream 755966 30833730 ~ 30835101 (+)
G2317562 LOC100196669 other downstream 1019855 31097619 ~ 31127687 (+)
G2317685 LOC106569887 other downstream 1144353 31222117 ~ 31223562 (+)
LOC110488286 chtop other downstream 1257055 31334757 ~ 31340531 (+)

Expression


LOC118946528 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

LOC118946528 Expression in each Bioproject

Bar chart with 14 bars.
LOC118946528 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network