G2287954



Basic Information


Item Value
gene id G2287954
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050572.1
NCBI id CM025859.1
chromosome length 41837469
location 1233466 ~ 1234223 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2616251
gacctagggtgtcttatgggttccagacctgaatctccctctctgacatagggtgtcttatgggatccagacctgaatctccatctctgacctagggtgtcttatgggttccagacctgaatcttcctctctgacctagggtgtcttatgggatccagacctgaatcttcctctctgacctagggtgtcttatgggttccagacctaggctgtcttatgggatccagaccttaatcttcatctctgaccaagggtgtcttatgggttccagacctgaatctccctctctgacatagggtgtcttatgggatccagacctgaatctccatctctgacctagggtgtcttatgggttccagagctgaatcttcatctctgacctagggtgtcttatgggttccagacctgaatctccctctctgacctagggtgtcttatgggttccagacctagggtgtcttatgggttccagacctagggtgtcttatgggttccagacctgaatcttcatctctgacctagggtgtcttatgggatccagacctgaatctccatctctgacctagggtgtctaataggttccagacctgaatcttcatctctgacctagggtgtcttatgggttccagacctagggtgtctaataggttccagacctgaaccttcttctctgacctagggtgtcttatgggttccagacctgaatcttcttctctgacctagggtgtcttatgggttccagagctgaatcttcatat

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2616251 True 758 lncRNA 0.49 1 1233466 1234223
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110487806 LOC106570773 coding upstream 271350 936322 ~ 962116 (+)
rims2b LOC106570772 coding upstream 333529 738621 ~ 899937 (+)
rnmt rnmt coding upstream 617039 596762 ~ 616427 (+)
seh1l seh1l coding upstream 646307 565124 ~ 587159 (+)
psmg2 psmg2 coding upstream 751309 476232 ~ 482157 (+)
ncaldb LOC105006551 coding downstream 46710 1280933 ~ 1361298 (+)
LOC110511936 spire1 coding downstream 366127 1600350 ~ 1639573 (+)
fam91a1 LOC106589122 coding downstream 477332 1711555 ~ 1825118 (+)
lratd2a LOC106589121 coding downstream 615237 1849460 ~ 1851250 (+)
LOC118946536 NA coding downstream 658367 1892590 ~ 1893952 (+)
G2287953 NA non-coding upstream 158 1232853 ~ 1233308 (+)
G2287936 NA non-coding upstream 1488 1086363 ~ 1231978 (+)
G2287942 NA non-coding upstream 12088 1196758 ~ 1221378 (+)
G2287940 NA non-coding upstream 16420 1117001 ~ 1217046 (+)
G2287937 NA non-coding upstream 136329 1096376 ~ 1097137 (+)
G2287974 NA non-coding downstream 40352 1274575 ~ 1275361 (+)
G2288015 NA non-coding downstream 96048 1330271 ~ 1334705 (+)
G2287981 NA non-coding downstream 128899 1363122 ~ 1369617 (+)
G2288035 NA non-coding downstream 153801 1388024 ~ 1389265 (+)
G2288040 NA non-coding downstream 160313 1394536 ~ 1400935 (+)
G2287470 NA other upstream 745805 486793 ~ 487661 (+)
rpl30 LOC106589133 other upstream 992826 233676 ~ 240640 (+)
G2287973 NA other downstream 39151 1273374 ~ 1274170 (+)
triqk triqk other downstream 974899 2209019 ~ 2255119 (+)
G2288669 NA other downstream 1087651 2321874 ~ 2324182 (+)
G2288814 NA other downstream 1146224 2380447 ~ 2381395 (+)
G2289325 NA other downstream 1826219 3060442 ~ 3060779 (+)

Expression


G2287954 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G2287954 Expression in each Bioproject

Bar chart with 4 bars.
G2287954 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network