G2290770



Basic Information


Item Value
gene id G2290770
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050572.1
NCBI id CM025859.1
chromosome length 41837469
location 4893036 ~ 4895448 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2619749
ATCTACATGTTATTACTAATACCTGGTCAGCTTATCTACACATTATTACTAATACCTGGTCAGCTTATCTACATGTTATTACTAATACCTGGTCAGCTTATCTACATGTTATTACTAATACCTGGTCAGCTTATCTACACGTTATTAATAATACCTGGTCAGCTTATCTACACGTTATTACTAATACCTGGTCAGCTTATCACAGTGTTATTACTAATACCTGGTCAGCTTATCTACATGTTATTACTAATACCTGGTCAGCTTATCTACATGTTATTACTAATACCTGGTCAGCTTATCACAGTGTTATTACTAATACCTGGTCAGCTTATCACAGTGTTATTACTAATACCTGGTCAGCTAATCTACACGTTATTACTAATACCTGTTCAGCTTATCTACATGTTAAAACTA

Function


NR:

description
PREDICTED: uncharacterized protein LOC106579575, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2619749 True 414 TUCP 0.34 2 4893036 4895448
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118946538 LOC106570740 coding downstream 570248 4110893 ~ 4322788 (-)
csmd2 LOC107698986 coding downstream 1013429 3495523 ~ 3879607 (-)
LOC118946526 csmd2 coding downstream 1399918 3447097 ~ 3493118 (-)
LOC110487827 LOC106570760 coding downstream 2013050 2863586 ~ 2879986 (-)
tdp2b tdp2 coding downstream 2030522 2854915 ~ 2862514 (-)
gja4 LOC106589111 coding upstream 145432 5040880 ~ 5067538 (-)
LOC118946459 NA coding upstream 521638 5417086 ~ 5418079 (-)
LOC110487843 LOC106570718 coding upstream 556900 5452348 ~ 5468330 (-)
zbtb8b LOC106570719 coding upstream 583710 5479158 ~ 5489347 (-)
gstr gsta coding upstream 643334 5538782 ~ 5544491 (-)
G2290766 NA non-coding downstream 8899 4879234 ~ 4884137 (-)
G2290762 NA non-coding downstream 15536 4870400 ~ 4877500 (-)
G2290751 NA non-coding downstream 35910 4856848 ~ 4857126 (-)
G2290749 NA non-coding downstream 37112 4855716 ~ 4855924 (-)
G2290711 NA non-coding downstream 64757 4828071 ~ 4828279 (-)
G2290799 NA non-coding upstream 35153 4930601 ~ 4931244 (-)
G2290800 NA non-coding upstream 38221 4933669 ~ 4933934 (-)
G2290803 NA non-coding upstream 41294 4936742 ~ 4936976 (-)
G2290810 NA non-coding upstream 48275 4943723 ~ 4944387 (-)
G2290826 NA non-coding upstream 62494 4957942 ~ 4958169 (-)
G2290764 NA other downstream 11209 4873107 ~ 4881827 (-)
G2290755 NA other downstream 30909 4861784 ~ 4862127 (-)
G2290685 NA other downstream 74334 4783622 ~ 4818702 (-)
G2290582 NA other downstream 215394 4677214 ~ 4677642 (-)
G2289513 NA other downstream 1507572 3384398 ~ 3385464 (-)
G2290832 NA other upstream 64838 4960286 ~ 4960665 (-)
G2290833 NA other upstream 65712 4961160 ~ 4961760 (-)
G2290915 NA other upstream 142017 5037465 ~ 5038317 (-)

Expression


G2290770 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G2290770 Expression in each Bioproject

Bar chart with 5 bars.
G2290770 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.

Co-expression Network