G2290826



Basic Information


Item Value
gene id G2290826
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050572.1
NCBI id CM025859.1
chromosome length 41837469
location 4957942 ~ 4958169 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2619810
CCTTAATGAACAATTTCTAAATGCCGTGTTGTATTATTCAGATGTGTTAAATTCTGTGCAACATGAGTGAGAAGCTAACAATGGAGCCAGACAGCTATAGCAACGAATGAGCAAAAAGTACTGAAGTTTGGATATACTGTAGAAAAGTGGTTCAGAAGAGAGGCTTGAAACAGGCAGACAAGAGAGGTGCTGATTACAGTCAAACTCATTATCGCCACTATCACCGAC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2619810 True 228 lncRNA 0.40 1 4957942 4958169
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118946538 LOC106570740 coding downstream 635154 4110893 ~ 4322788 (-)
csmd2 LOC107698986 coding downstream 1078335 3495523 ~ 3879607 (-)
LOC118946526 csmd2 coding downstream 1464824 3447097 ~ 3493118 (-)
LOC110487827 LOC106570760 coding downstream 2077956 2863586 ~ 2879986 (-)
tdp2b tdp2 coding downstream 2095428 2854915 ~ 2862514 (-)
gja4 LOC106589111 coding upstream 82711 5040880 ~ 5067538 (-)
LOC118946459 NA coding upstream 458917 5417086 ~ 5418079 (-)
LOC110487843 LOC106570718 coding upstream 494179 5452348 ~ 5468330 (-)
zbtb8b LOC106570719 coding upstream 520989 5479158 ~ 5489347 (-)
gstr gsta coding upstream 580613 5538782 ~ 5544491 (-)
G2290810 NA non-coding downstream 13555 4943723 ~ 4944387 (-)
G2290803 NA non-coding downstream 20966 4936742 ~ 4936976 (-)
G2290800 NA non-coding downstream 24008 4933669 ~ 4933934 (-)
G2290799 NA non-coding downstream 26698 4930601 ~ 4931244 (-)
G2290766 NA non-coding downstream 73805 4879234 ~ 4884137 (-)
G2290828 NA non-coding upstream 224 4958393 ~ 4958649 (-)
G2290836 NA non-coding upstream 27389 4985558 ~ 4985871 (-)
G2290900 NA non-coding upstream 55899 5014068 ~ 5014426 (-)
G2290907 NA non-coding upstream 73051 5031220 ~ 5032054 (-)
G2290930 NA non-coding upstream 122085 5080254 ~ 5080564 (-)
G2290770 NA other downstream 62494 4893036 ~ 4895448 (-)
G2290764 NA other downstream 76115 4873107 ~ 4881827 (-)
G2290755 NA other downstream 95815 4861784 ~ 4862127 (-)
G2290685 NA other downstream 139240 4783622 ~ 4818702 (-)
G2290582 NA other downstream 280300 4677214 ~ 4677642 (-)
G2290832 NA other upstream 2117 4960286 ~ 4960665 (-)
G2290833 NA other upstream 2991 4961160 ~ 4961760 (-)
G2290915 NA other upstream 79296 5037465 ~ 5038317 (-)

Expression


G2290826 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G2290826 Expression in each Bioproject

Bar chart with 11 bars.
G2290826 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 6.
End of interactive chart.

Co-expression Network