G2290939



Basic Information


Item Value
gene id G2290939
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050572.1
NCBI id CM025859.1
chromosome length 41837469
location 5094972 ~ 5095172 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2619946
agggatttttactcctaaacacgttctgttatagccacagacccgatttaaccagttttagaaacttcagagtgttttctatccacacatacttatcatatgcatatactatattcctggcatgagtagcaggactttgaaatgttgcgcgatttttaacaaaaagctgcgaaaatttgcatcatccataacaggttttaa

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2619946 True 201 lncRNA 0.36 1 5094972 5095172
Loading

Neighbor


gene id symbol gene type direction distance location
gja4 LOC106589111 coding downstream 27434 5040880 ~ 5067538 (-)
LOC118946538 LOC106570740 coding downstream 772184 4110893 ~ 4322788 (-)
csmd2 LOC107698986 coding downstream 1215365 3495523 ~ 3879607 (-)
LOC118946526 csmd2 coding downstream 1601854 3447097 ~ 3493118 (-)
LOC110487827 LOC106570760 coding downstream 2214986 2863586 ~ 2879986 (-)
LOC118946459 NA coding upstream 321914 5417086 ~ 5418079 (-)
LOC110487843 LOC106570718 coding upstream 357176 5452348 ~ 5468330 (-)
zbtb8b LOC106570719 coding upstream 383986 5479158 ~ 5489347 (-)
gstr gsta coding upstream 443610 5538782 ~ 5544491 (-)
tert tert coding upstream 584527 5679699 ~ 5697347 (-)
G2290937 NA non-coding downstream 1470 5093295 ~ 5093502 (-)
G2290934 NA non-coding downstream 9187 5085524 ~ 5085785 (-)
G2290932 NA non-coding downstream 10814 5083920 ~ 5084158 (-)
G2290930 NA non-coding downstream 14408 5080254 ~ 5080564 (-)
G2290907 NA non-coding downstream 62918 5031220 ~ 5032054 (-)
G2290958 NA non-coding upstream 15755 5110927 ~ 5111168 (-)
G2291102 NA non-coding upstream 67667 5162839 ~ 5163770 (-)
G2291116 NA non-coding upstream 104414 5199586 ~ 5199982 (-)
G2291149 NA non-coding upstream 202192 5297364 ~ 5301159 (-)
G2291169 NA non-coding upstream 256144 5351316 ~ 5352789 (-)
G2290915 NA other downstream 56655 5037465 ~ 5038317 (-)
G2290833 NA other downstream 133212 4961160 ~ 4961760 (-)
G2290832 NA other downstream 134307 4960286 ~ 4960665 (-)
G2290770 NA other downstream 199524 4893036 ~ 4895448 (-)
G2291639 NA other upstream 413315 5508487 ~ 5509139 (-)
G2292176 NA other upstream 1481903 6577075 ~ 6577556 (-)
G2292514 NA other upstream 1846104 6941276 ~ 6946764 (-)
G2293096 NA other upstream 2555308 7650480 ~ 7651999 (-)

Expression


G2290939 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G2290939 Expression in each Bioproject

Bar chart with 15 bars.
G2290939 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network