G2291430



Basic Information


Item Value
gene id G2291430
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050572.1
NCBI id CM025859.1
chromosome length 41837469
location 5991397 ~ 5997376 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2620607
aacctagaggagactaaactagaggtgactaaactagaggagactaaactagaggtgactaacctagaggagactaacctagaggagactaacctagaggagactaaactagaggagactaaactagaggagactaacctagaggagactaaactagaggagactaaactagaggagactaaactagaggagactaaacaagagg

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2620607 True 205 lncRNA 0.42 2 5991397 5997376

Neighbor


gene id symbol gene type direction distance location
LOC110489352 LOC106570724 coding upstream 134657 5819080 ~ 5856740 (+)
wipf3 NA coding upstream 241661 5724270 ~ 5749736 (+)
LOC110489437 LOC106570711 coding upstream 313493 5645183 ~ 5677904 (+)
slc6a18 LOC106570711 coding upstream 349850 5632297 ~ 5641547 (+)
LOC110489357 slc6a19 coding upstream 376024 5592112 ~ 5615373 (+)
LOC110520219 NA coding downstream 49214 6046590 ~ 6047475 (+)
LOC110487836 LOC106570725 coding downstream 113003 6110379 ~ 6203899 (+)
LOC118946494 NA coding downstream 396939 6394261 ~ 6398382 (+)
LOC110487847 LOC106570705 coding downstream 654088 6651464 ~ 6676974 (+)
LOC110489360 LOC105005722 coding downstream 805657 6803033 ~ 6867523 (+)
G2291428 NA non-coding upstream 2628 5987148 ~ 5988769 (+)
G2291420 NA non-coding upstream 10714 5978396 ~ 5980683 (+)
G2291406 NA non-coding upstream 44135 5945919 ~ 5947262 (+)
G2291405 NA non-coding upstream 45230 5945168 ~ 5946167 (+)
G2291392 NA non-coding upstream 74468 5915567 ~ 5916929 (+)
G2291449 NA non-coding downstream 39272 6036648 ~ 6040574 (+)
G2291452 NA non-coding downstream 46838 6044214 ~ 6045878 (+)
G2291476 NA non-coding downstream 119429 6116805 ~ 6244236 (+)
G2291480 NA non-coding downstream 126767 6124143 ~ 6124536 (+)
G2291498 NA non-coding downstream 163702 6161078 ~ 6161719 (+)
G2291219 NA other upstream 519244 5471563 ~ 5472153 (+)
G2291194 NA other upstream 573159 5416832 ~ 5418238 (+)
dlgap3 dlgap3 other upstream 583889 5113201 ~ 5412625 (+)
smim12 smim12 other upstream 973083 5014549 ~ 5018314 (+)
G2291490 NA other downstream 150448 6147824 ~ 6148246 (+)
G2291541 NA other downstream 310760 6308136 ~ 6316697 (+)
G2292347 NA other downstream 885001 6882377 ~ 6883166 (+)
G2292666 NA other downstream 1192876 7190252 ~ 7190850 (+)

Expression


G2291430 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G2291430 Expression in each Bioproject

Bar chart with 4 bars.
G2291430 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.

Co-expression Network