G2293464



Basic Information


Item Value
gene id G2293464
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050572.1
NCBI id CM025859.1
chromosome length 41837469
location 8105628 ~ 8106009 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2623152
ggggggggggaagacgagcgggggcgcgaagaacgggcttgacacaggagacatggaagaccgggtggacgcgacgaagatatcgcggcagaagaaggcgcactgcgacagggttaatgatttgagagatacggaatggaccaatgaaccgcggggtcaacttgcgagaagccgtcttaaggggaaggttctgagtggagagccaaactctctgaccgcgacaatatctagggctcttcgttctacgcttattagcagctctcacagtctgcgccctataacggcaaagtgcagacctgaccctcttccaggtgcgctcgcaacgttggacaaaagcctgagcggaggggacgctggactcggcgaactgagatgagaacaa

Function


NR:

description
PREDICTED: uncharacterized protein LOC106524420

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2623152 True 382 TUCP 0.57 1 8105628 8106009

Neighbor


gene id symbol gene type direction distance location
e2f3 LOC106570699 coding upstream 186178 7897661 ~ 7920212 (+)
LOC118946479 NA coding upstream 226052 7878210 ~ 7881862 (+)
LOC110489363 LOC106589070 coding upstream 259312 7801891 ~ 7846316 (+)
LOC110487859 LOC106570693 coding upstream 514828 7571850 ~ 7590800 (+)
LOC110487858 LOC106589075 coding upstream 542590 7527363 ~ 7563955 (+)
LOC110487863 LOC106569297 coding downstream 92655 8197381 ~ 8202360 (+)
si:ch211-152p11.4 LOC106570678 coding downstream 304395 8410404 ~ 8420764 (+)
tnfa LOC100136509 coding downstream 397615 8503624 ~ 8506000 (+)
LOC118946524 uap56 coding downstream 720901 8826910 ~ 8833518 (+)
LOC110487872 LOC106570657 coding downstream 785630 8891639 ~ 8896196 (+)
G2293462 NA non-coding upstream 330 8105014 ~ 8105298 (+)
G2293443 NA non-coding upstream 15103 8087909 ~ 8090525 (+)
G2293441 NA non-coding upstream 20674 8084715 ~ 8084954 (+)
G2293394 NA non-coding upstream 83577 8021074 ~ 8022051 (+)
G2293381 NA non-coding upstream 94800 8010616 ~ 8010828 (+)
G2293486 NA non-coding downstream 39216 8145225 ~ 8145792 (+)
G2293496 NA non-coding downstream 55437 8161446 ~ 8162454 (+)
G2293507 NA non-coding downstream 64110 8170119 ~ 8170389 (+)
G2293510 NA non-coding downstream 65126 8171135 ~ 8171351 (+)
G2293512 NA non-coding downstream 65841 8171850 ~ 8172137 (+)
G2293430 NA other upstream 27247 8075687 ~ 8078381 (+)
G2293172 NA other upstream 258166 7846541 ~ 7847462 (+)
G2292666 NA other upstream 914778 7190252 ~ 7190850 (+)
G2292347 NA other upstream 1222462 6882377 ~ 6883166 (+)
G2293677 NA other downstream 244204 8350213 ~ 8350683 (+)
G2293829 NA other downstream 404863 8510872 ~ 8511770 (+)
G2293942 NA other downstream 685092 8791101 ~ 8876464 (+)
G2293943 LOC106570655 other downstream 738004 8844013 ~ 8847252 (+)
G2294081 NA other downstream 988783 9094792 ~ 9103186 (+)

Expression


G2293464 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G2293464 Expression in each Bioproject

Bar chart with 18 bars.
G2293464 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network