G2294410



Basic Information


Item Value
gene id G2294410
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050572.1
NCBI id CM025859.1
chromosome length 41837469
location 9251070 ~ 9251285 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2624336
AGCTGGAGCTTCTCAGATTTCCTGGAGTGTCTGTTATAATGGATACGTCACACGTACCAATGGTCTTTTGATAGGGAAATGTTCTTCTCTCGTCTTCGGTCGAGTTTCCTAGACTATTTTACATACACAGCTGCAGACTGTGAATGTGTAGTCTTTAGTTTTGTAGATTTCTTAACCATTTGTAACGTATTCAGTTGGCGCTGCATGCAACTAGAG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2624336 True 216 lncRNA 0.41 1 9251070 9251285
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110489366 LOC105012323 coding upstream 88574 9046596 ~ 9162941 (+)
LOC110487879 LOC106570673 coding upstream 231601 9005647 ~ 9019469 (+)
stx12 LOC106570663 coding upstream 296120 8942998 ~ 8954950 (+)
LOC110487875 LOC106570662 coding upstream 308593 8934130 ~ 8942477 (+)
LOC110489365 LOC106570660 coding upstream 317041 8907450 ~ 8934029 (+)
LOC118946539 NA coding downstream 73055 9324340 ~ 9325002 (+)
trnap-agg-161 NA coding downstream 102532 9353817 ~ 9353888 (+)
trnap-agg-163 NA coding downstream 105806 9357091 ~ 9357162 (+)
trnap-agg-165 NA coding downstream 111764 9363049 ~ 9363120 (+)
trnap-agg-167 NA coding downstream 115038 9366323 ~ 9366394 (+)
G2294083 NA non-coding upstream 93041 9108619 ~ 9158029 (+)
G2294096 NA non-coding upstream 111083 9139295 ~ 9139987 (+)
G2294080 NA non-coding upstream 159420 9090425 ~ 9091650 (+)
G2294062 NA non-coding upstream 203335 9047480 ~ 9047735 (+)
G2294412 NA non-coding downstream 262 9251547 ~ 9251752 (+)
G2294421 NA non-coding downstream 15471 9266756 ~ 9268052 (+)
G2294448 NA non-coding downstream 76165 9327450 ~ 9328654 (+)
G2294449 NA non-coding downstream 78974 9330259 ~ 9330708 (+)
G2294457 NA non-coding downstream 93476 9344761 ~ 9345078 (+)
G2294081 NA other upstream 147884 9094792 ~ 9103186 (+)
G2293943 LOC106570655 other upstream 403818 8844013 ~ 8847252 (+)
G2293942 NA other upstream 455568 8791101 ~ 8876464 (+)
G2293829 NA other upstream 739329 8510872 ~ 8511770 (+)
G2293677 NA other upstream 900387 8350213 ~ 8350683 (+)
G2294452 LOC106570648 other downstream 84050 9335335 ~ 9337755 (+)
G2294925 NA other downstream 878831 10130116 ~ 10131651 (+)
LOC118946540 NA other downstream 1067567 10318805 ~ 10323588 (+)
LOC110487904 snrpd1 other downstream 1263669 10509464 ~ 10521398 (+)
G2296150 LOC106570575 other downstream 2034208 11285493 ~ 11290303 (+)

Expression


G2294410 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G2294410 Expression in each Bioproject

Bar chart with 12 bars.
G2294410 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network