G2294998


Basic Information

Item Value
gene id G2294998
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_050572.1
NCBI id CM025859.1
chromosome length 41837469
location 10311406 ~ 10344133 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU2625076
aagaaaatattgctttatttatctgatcatattgtaatatatttgttaggttttcagtaggttcaattaggttcactagactatatgcgtcatttaaaaatttttcaatgaacattcgaacagtccggccctcgtcttgtagctgatttttttatttggccctccgtccatttgactttgacacccctggtatagagggaaatagtcctataattcctataataactacaacctaaaacttcttacctgggaatattgaagactcatgttaaaaggaaccaccagctttcatatgttctcatgttctgagcaaggaactgaaacgttagctttcttaca
>TU2625077
aagaaaatattgctttatttatctgatcatattgtaatatatttgttaggttttcagtaggttcaattaggttcactagactatatgcgtcatttaaaaatttttcaatgaacattcgaacagtccggccctcgtcttgtagctgatttttttatttggccctccgtccatttgactttgacacccctggtatagagggaaatagtcctataattcctataataactacaacctaaaactgcttacctgggaatattgaagactcatgttaaaaggaaccaccagctttcatatgttctcatgttctgagcaaggaactgaaacgttagctttcttacatagcacatattgcacttttactttcttctccaacactttgtttttgcattatttaaaacaaactgaacatgtttcattatttacttgagactaaattgattatattgatgtattatattaagttaaaataagtgttcattcagtattgctgtaattg

Function

NR:

description
PREDICTED: CUB and zona pellucida-like domain-containing protein 1, partial

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU2625076 False 339 lncRNA 0.35 2 10311406 10344004
TU2625077 True 496 lncRNA 0.32 2 10311406 10344133

Neighbor

gene id symbol gene type direction distance location
LOC118946535 NA coding upstream 218878 10091303 ~ 10092528 (+)
LOC110487893 LOC106570636 coding upstream 247380 10049196 ~ 10064026 (+)
LOC110487884 LOC106570642 coding upstream 686711 9622027 ~ 9624695 (+)
cck-t cck-t coding upstream 737626 9568052 ~ 9573780 (+)
LOC110489367 LOC106570646 coding upstream 778744 9489794 ~ 9532662 (+)
LOC110513484 LOC106570612 coding downstream 60239 10404372 ~ 10427604 (+)
si:ch211-199g17.9 syce1 coding downstream 93544 10437677 ~ 10441669 (+)
LOC110489372 LOC106570609 coding downstream 122232 10466365 ~ 10490055 (+)
LOC110489373 LOC106570620 coding downstream 162960 10507093 ~ 10509282 (+)
LOC110487904 snrpd1 coding downstream 165331 10509464 ~ 10521398 (+)
G2294996 NA non-coding upstream 5110 10305029 ~ 10306296 (+)
G2294991 NA non-coding upstream 31506 10279528 ~ 10279900 (+)
G2294962 NA non-coding upstream 61086 10229834 ~ 10250320 (+)
G2294970 NA non-coding upstream 69194 10241594 ~ 10242212 (+)
G2294964 NA non-coding upstream 77063 10233727 ~ 10234343 (+)
G2295044 NA non-coding downstream 72016 10416149 ~ 10416526 (+)
G2295030 NA non-coding downstream 86548 10430681 ~ 10492480 (+)
G2295032 NA non-coding downstream 104248 10448381 ~ 10466224 (+)
G2295062 NA non-coding downstream 123992 10468125 ~ 10472642 (+)
G2294925 NA other upstream 179755 10130116 ~ 10131651 (+)
G2294452 LOC106570648 other upstream 973651 9335335 ~ 9337755 (+)
G2294081 NA other upstream 1208220 9094792 ~ 9103186 (+)
G2293943 LOC106570655 other upstream 1464154 8844013 ~ 8847252 (+)
G2293942 NA other upstream 1515904 8791101 ~ 8876464 (+)
G2296150 LOC106570575 other downstream 941360 11285493 ~ 11290303 (+)
G2296278 NA other downstream 1219414 11563547 ~ 11564590 (+)
LOC110487932 LOC106570557 other downstream 1562574 11906205 ~ 11910366 (+)
G2296450 NA other downstream 1571063 11915196 ~ 11977297 (+)

Expression


Co-expression Network