G2297247



Basic Information


Item Value
gene id G2297247
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050572.1
NCBI id CM025859.1
chromosome length 41837469
location 12345401 ~ 12346298 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2627984
ccctattccctatatagtgcactacttttgaccagagccctattccctctagagtgcactactttagaccagagccctattcccttcatagttcactacttttgaccagagccctattcccttcatagttcactactttagaccagagccctattccctttagagtgcactactttagaccagagccctattccctttagagtgcactacttttgaccagagccctattcccttcatagttcactactttagaccagagcactattcccttcatagttcactacttttgaccagagccctattccctttagagtgcactactttagaccagagccctattccctttagagtgcactactttagaccagagccctattccctttagagtgcactactttaaatatttttgatagaacc
>TU2627986
ccctattccctatatagtgcactacttttgaccagagccctattccctctatagtgcactacttttgaccagagcccttttccctatatagtgcactacttttgatcagagccctattccctatatagtgcattacttttgaccagagccctattccctctatagtgcactacttttgaccagagcccttttccctatatagtgcactacttttgatcagagccctattccctatatagtgcactacttttgaccagagccctattccctttaaagtgcactactttagaccagagccctattcccttcatagttcactacttttgatcagagccctattcccttcatagttcactactttagaccagagccctattcccttcatagttcactacttttgaccagagccctattcccttcatagttcactactttagaccagagccctattccctttagagtgcactactttagaccagagccctattccctttagagtgcactactttagaccagagccctattccctttagagtgcactactttagaccagagccctattccctttagagtgcactactttaaatatttttgatagaacc

Function


NR:

description
PREDICTED: uncharacterized protein LOC106562210, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2627984 False 417 lncRNA 0.43 2 12345401 12346298
TU2627986 True 602 lncRNA 0.43 3 12345401 12346298
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110487923 LOC106588825 coding downstream 198718 12130756 ~ 12146683 (-)
LOC110487922 LOC106570548 coding downstream 220157 12119349 ~ 12125244 (-)
LOC110487933 LOC106570558 coding downstream 415509 11916968 ~ 11929892 (-)
LOC110487928 LOC106590894 coding downstream 533693 11765257 ~ 11811708 (-)
LOC110487921 mrpl53 coding downstream 796663 11545239 ~ 11548738 (-)
LOC110489382 LOC106570512 coding upstream 1656792 14003090 ~ 14039542 (-)
npvf LOC106570543 coding upstream 1698062 14044360 ~ 14049475 (-)
hoxa1a hoxa1 coding upstream 2065682 14411980 ~ 14415021 (-)
hoxa3a hoxa3aa coding upstream 2072320 14418618 ~ 14459316 (-)
hoxa4a hoxa4ab coding upstream 2095591 14441889 ~ 14445381 (-)
G2297241 NA non-coding downstream 15748 12328457 ~ 12329653 (-)
G2297197 NA non-coding downstream 43491 12239275 ~ 12301910 (-)
G2297199 NA non-coding downstream 101597 12241331 ~ 12243804 (-)
G2297035 NA non-coding downstream 118553 12226253 ~ 12226848 (-)
G2297034 NA non-coding downstream 120613 12224554 ~ 12224788 (-)
G2297260 NA non-coding upstream 23719 12370017 ~ 12373227 (-)
G2297305 NA non-coding upstream 100494 12446792 ~ 12447256 (-)
G2297273 NA non-coding upstream 108126 12454424 ~ 12472240 (-)
G2297317 NA non-coding upstream 139793 12486091 ~ 12486305 (-)
G2297335 NA non-coding upstream 169770 12516068 ~ 12516294 (-)
G2296582 NA other downstream 857021 11481605 ~ 11488380 (-)
LOC110487919 LOC106570575 other downstream 889496 11274255 ~ 11455993 (-)
G2295895 NA other downstream 1556842 10788107 ~ 10788559 (-)
LOC110489370 clasp2 other downstream 2135576 10205530 ~ 10316136 (-)
G2298681 NA other upstream 1304403 13650701 ~ 13651184 (-)
G2298700 NA other upstream 1356403 13702701 ~ 13702996 (-)
G2299075 NA other upstream 1717581 14063879 ~ 14067899 (-)
G2302281 NA other upstream 4924238 17270536 ~ 17271016 (-)
G2303058 NA other upstream 4978928 17325226 ~ 17326420 (-)

Expression


G2297247 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G2297247 Expression in each Bioproject

Bar chart with 12 bars.
G2297247 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network