G2309397



Basic Information


Item Value
gene id G2309397
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050572.1
NCBI id CM025859.1
chromosome length 41837469
location 24193529 ~ 24193971 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2641717
cctcaggactacctgacatgatgactccttgctgtccccagtccacctggacgtgatgctgctccagtttaaactgttctgccttattattattcgaccatgctggtcacttatgaacatttgaacatcttggccatgttctgttataatctcctcccggcacagccagaagaggactggccaccccacatagcctggttcctctctaggtttcttcctaggttttggcctttctagggagtttttcctagccaccgtgcttctacacctgcattgcttgctgtttggggttttaggctgggtttctgtacagcactttgagatatcagcggatgtacgaagggctatataaataaatttgatttgatttgatttgatttaacagtacacattacattcacagaagttccaaaagaataaaggcatttcaaatgtcatatgtc

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2641717 True 443 lncRNA 0.44 1 24193529 24193971
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110488142 LOC106570295 coding upstream 36056 24151527 ~ 24157473 (+)
sdhaf3 LOC106570289 coding upstream 109143 24065828 ~ 24084386 (+)
LOC110488137 LOC106606710 coding upstream 134212 24044440 ~ 24059317 (+)
LOC110488133 NA coding upstream 211546 23979350 ~ 23981983 (+)
LOC118946518 NA coding upstream 375497 23814596 ~ 23818032 (+)
LOC110488145 LOC106570298 coding downstream 9799 24203770 ~ 24215296 (+)
ngly1 ngly1 coding downstream 215890 24409861 ~ 24420001 (+)
LOC110488151 LOC106570304 coding downstream 226203 24420174 ~ 24467243 (+)
LOC110488157 LOC106588669 coding downstream 603347 24797318 ~ 24915300 (+)
LOC110488160 LOC106588667 coding downstream 749456 24943427 ~ 24951969 (+)
G2309329 NA non-coding upstream 18135 24160495 ~ 24175394 (+)
G2309384 LOC106570297 non-coding upstream 22776 24169629 ~ 24170753 (+)
G2309346 NA non-coding upstream 86417 24106224 ~ 24107112 (+)
G2309342 NA non-coding upstream 93693 24099564 ~ 24099836 (+)
G2309324 NA non-coding upstream 105414 24087692 ~ 24088115 (+)
G2309398 NA non-coding downstream 3017 24196988 ~ 24209748 (+)
G2309330 NA non-coding downstream 23915 24217886 ~ 24218828 (+)
G2309333 NA non-coding downstream 24987 24218958 ~ 24219844 (+)
G2309405 NA non-coding downstream 27033 24221004 ~ 24221240 (+)
G2309407 NA non-coding downstream 28731 24222702 ~ 24222970 (+)
G2308224 NA other upstream 1588808 22604320 ~ 22604721 (+)
c32h5orf49 cssa14h5orf49 other upstream 1777237 22405971 ~ 22416346 (+)
G2306825 NA other upstream 2606095 21587088 ~ 21587434 (+)
G2311528 NA other downstream 1541223 25735194 ~ 25736847 (+)
G2311978 NA other downstream 1725181 25919152 ~ 25919800 (+)
G2312300 NA other downstream 2131181 26325152 ~ 26325383 (+)
G2312752 NA other downstream 2539333 26733304 ~ 26733645 (+)
LOC110488193 LOC106570239 other downstream 2622713 26816398 ~ 26820899 (+)

Expression


G2309397 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G2309397 Expression in each Bioproject

Bar chart with 17 bars.
G2309397 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.

Co-expression Network