G2311883



Basic Information


Item Value
gene id G2311883
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050572.1
NCBI id CM025859.1
chromosome length 41837469
location 25847789 ~ 25847993 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2644482
ctttagccacatttcagccttcaaacataaagatataaaactgtatttttttgtgaagaatcaacaacaagtgggacacaatcatgaagtggaacgacattgattggatatttcaacttttttaacaaatcaaaaactgaaaaattgggcgtgcaaaattattcagcccccttaagttaatactttgtagcgccaccttttgctg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2644482 True 205 lncRNA 0.34 1 25847789 25847993
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110488174 LOC106588632 coding downstream 318638 25528117 ~ 25529151 (-)
LOC118946560 NA coding downstream 389862 25457791 ~ 25457927 (-)
LOC118946558 NA coding downstream 390193 25457520 ~ 25457596 (-)
LOC118946559 NA coding downstream 390688 25457021 ~ 25457101 (-)
LOC118946555 NA coding downstream 391534 25456183 ~ 25456255 (-)
LOC110488175 LOC106570260 coding upstream 147585 25995578 ~ 26002997 (-)
LOC110488176 LOC106570259 coding upstream 171327 26019320 ~ 26043739 (-)
LOC110488182 LOC106570253 coding upstream 450720 26298713 ~ 26322682 (-)
zdhhc18b LOC106570247 coding upstream 727454 26575447 ~ 26583341 (-)
LOC110488185 LOC106570245 coding upstream 746105 26594098 ~ 26661878 (-)
G2311874 NA non-coding downstream 4983 25842543 ~ 25842806 (-)
G2311601 NA non-coding downstream 389190 25455277 ~ 25458599 (-)
G2311206 NA non-coding downstream 579082 25268502 ~ 25268707 (-)
G2311191 NA non-coding downstream 593860 25253703 ~ 25253929 (-)
G2311189 NA non-coding downstream 595415 25252168 ~ 25252374 (-)
G2311929 NA non-coding upstream 11552 25859545 ~ 25859787 (-)
G2311930 NA non-coding upstream 12645 25860638 ~ 25860905 (-)
G2311939 NA non-coding upstream 24391 25872384 ~ 25872794 (-)
G2311976 NA non-coding upstream 68453 25916446 ~ 25916720 (-)
G2311979 NA non-coding upstream 71140 25919133 ~ 25919769 (-)
G2311141 NA other downstream 684659 25162692 ~ 25163130 (-)
umad1 LOC106588684 other downstream 1868536 23962314 ~ 23979279 (-)
G2310415 NA other downstream 2029783 23816297 ~ 23818006 (-)
G2310381 LOC106570311 other downstream 2086438 23760515 ~ 23761351 (-)
LOC118946453 NA other downstream 2863655 22979779 ~ 22984566 (-)
G2312079 LOC106582599 other upstream 120990 25968983 ~ 25969361 (-)
G2313729 NA other upstream 676251 26524244 ~ 26524609 (-)
LOC110488229 LOC106570201 other upstream 3446263 29283078 ~ 29318812 (-)
G2316235 NA other upstream 3649937 29497930 ~ 29500245 (-)
G2316696 NA other upstream 4186305 30034298 ~ 30039597 (-)

Expression


G2311883 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G2311883 Expression in each Bioproject

Bar chart with 14 bars.
G2311883 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network