G2313762



Basic Information


Item Value
gene id G2313762
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050572.1
NCBI id CM025859.1
chromosome length 41837469
location 26586271 ~ 26586573 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2646520
cataaataagatctggtgcaaccaattaccttcagaagtcacataattagttaaataaagtgttacatgatctgtcacatgatctcatcatactgctaaagcaacactcaagtggtttaaggggaaacatttaaatgtcttggaatggcctaaaagcccagacctcaatccaattgagaatctgtggtatgacctaaatattgctgtacaccagcagaacccatccaacttgaaggagctggagcagttttgccttgaataacgggcaaaaatcccagtggttagatatgccaagcttataga

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2646520 True 303 lncRNA 0.39 1 26586271 26586573
Loading

Neighbor


gene id symbol gene type direction distance location
zdhhc18b LOC106570247 coding downstream 2930 26575447 ~ 26583341 (-)
LOC110488182 LOC106570253 coding downstream 263589 26298713 ~ 26322682 (-)
LOC110488176 LOC106570259 coding downstream 542532 26019320 ~ 26043739 (-)
LOC110488175 LOC106570260 coding downstream 583274 25995578 ~ 26002997 (-)
LOC110488174 LOC106588632 coding downstream 1057120 25528117 ~ 25529151 (-)
LOC110488185 LOC106570245 coding upstream 7525 26594098 ~ 26661878 (-)
ntl ntl coding upstream 97406 26683979 ~ 26687789 (-)
LOC110488186 nudc coding upstream 118643 26705216 ~ 26712886 (-)
LOC110488187 LOC106570243 coding upstream 130206 26716779 ~ 26745316 (-)
LOC110488190 tpbg coding upstream 174552 26761125 ~ 26764690 (-)
G2313752 NA non-coding downstream 23587 26562366 ~ 26562684 (-)
G2313730 NA non-coding downstream 60279 26525760 ~ 26525992 (-)
G2313728 NA non-coding downstream 63048 26522991 ~ 26523223 (-)
G2313723 NA non-coding downstream 70019 26515998 ~ 26516252 (-)
G2313722 NA non-coding downstream 71524 26514540 ~ 26514747 (-)
G2313763 NA non-coding upstream 187 26586760 ~ 26587066 (-)
G2313764 NA non-coding upstream 1108 26587681 ~ 26588051 (-)
G2313765 NA non-coding upstream 1897 26588470 ~ 26588766 (-)
G2313807 NA non-coding upstream 83121 26669694 ~ 26669907 (-)
G2313825 NA non-coding upstream 117632 26704205 ~ 26704464 (-)
G2313729 NA other downstream 61662 26524244 ~ 26524609 (-)
G2312079 LOC106582599 other downstream 616910 25968983 ~ 25969361 (-)
G2311141 NA other downstream 1423141 25162692 ~ 25163130 (-)
umad1 LOC106588684 other downstream 2607018 23962314 ~ 23979279 (-)
G2310415 NA other downstream 2768265 23816297 ~ 23818006 (-)
LOC110488229 LOC106570201 other upstream 2707683 29283078 ~ 29318812 (-)
G2316235 NA other upstream 2911357 29497930 ~ 29500245 (-)
G2316696 NA other upstream 3447725 30034298 ~ 30039597 (-)
G2318269 NA other upstream 4548934 31135507 ~ 31135959 (-)
LOC110488289 LOC106569889 other upstream 4736815 31323368 ~ 31334791 (-)

Expression


G2313762 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G2313762 Expression in each Bioproject

Bar chart with 14 bars.
G2313762 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network