G2315302



Basic Information


Item Value
gene id G2315302
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050572.1
NCBI id CM025859.1
chromosome length 41837469
location 28810240 ~ 28810537 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2648220
gttttcagctgtactaacataattgcaaaagtgttttctaatgatcaattagccttttaaaatgataaacttggattagctaacacaacgtgccattggaacacaggagtgatggttgctgataatgggcctctgtacacctacgtagatattccattcaaaatcagccgtttccagctacaatagtcatttacaacattaacaatgtctacactgtatttctgatcaatgtgatgttattttaatggacaacagatgtgcttttctttcaaaaacaaggacatttctaagtgacccc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2648220 True 298 lncRNA 0.36 1 28810240 28810537

Neighbor


gene id symbol gene type direction distance location
LOC110488216 LOC106570190 coding upstream 338880 28468750 ~ 28471360 (+)
LOC110488215 LOC106570189 coding upstream 372249 28436066 ~ 28437991 (+)
LOC110488210 LOC106570183 coding upstream 425352 28299685 ~ 28384888 (+)
LOC110488207 NA coding upstream 718410 28083355 ~ 28091830 (+)
kcng2 LOC106570224 coding upstream 765652 28016566 ~ 28047334 (+)
LOC110489419 ssr2 coding downstream 172651 28983188 ~ 28994465 (+)
LOC110489420 LOC106570197 coding downstream 207024 29017561 ~ 29042431 (+)
LOC110488225 LOC106588560 coding downstream 359302 29169839 ~ 29271629 (+)
LOC110488226 rpc7l coding downstream 405099 29215636 ~ 29223759 (+)
LOC118946464 NA coding downstream 555890 29366427 ~ 29369552 (+)
G2315294 NA non-coding upstream 3044 28806978 ~ 28807196 (+)
G2315279 NA non-coding upstream 15187 28794840 ~ 28795053 (+)
G2314975 NA non-coding upstream 21337 28662836 ~ 28788903 (+)
G2314988 NA non-coding upstream 101656 28702007 ~ 28708584 (+)
G2314883 NA non-coding upstream 256252 28516452 ~ 28553988 (+)
G2315304 NA non-coding downstream 247 28810784 ~ 28811014 (+)
G2315306 NA non-coding downstream 2417 28812954 ~ 28813283 (+)
G2315312 LOC106562530 non-coding downstream 5298 28815835 ~ 28816121 (+)
G2315320 NA non-coding downstream 10633 28821170 ~ 28821499 (+)
G2315322 NA non-coding downstream 11417 28821954 ~ 28822265 (+)
G2314987 NA other upstream 106816 28698740 ~ 28703424 (+)
G2314887 NA other upstream 246645 28520255 ~ 28563595 (+)
G2313197 NA other upstream 1316505 27493099 ~ 27493735 (+)
LOC118946485 LOC106570234 other upstream 1607429 27197844 ~ 27202811 (+)
G2316421 NA other downstream 1111847 29922384 ~ 29931480 (+)
tmem79a LOC106569868 other downstream 2007491 30817937 ~ 30822555 (+)
G2317455 NA other downstream 2023193 30833730 ~ 30835101 (+)
G2317562 LOC100196669 other downstream 2287082 31097619 ~ 31127687 (+)
G2317685 LOC106569887 other downstream 2411580 31222117 ~ 31223562 (+)

Expression


G2315302 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G2315302 Expression in each Bioproject

Bar chart with 20 bars.
G2315302 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network