G2316335



Basic Information


Item Value
gene id G2316335
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050572.1
NCBI id CM025859.1
chromosome length 41837469
location 29727923 ~ 29728128 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2649324
tgtaacatgtaaagtgttggtcccatgtttcatgagctgaaataaaaataacccagaaatgttccatacgtctgaaaagcttatttctctcaaattttgtgcacaaatttgtttacatccctgttagtgagcatttctcttttgtcaagataatccattcacctgacaggtgtggcatatgaagaagctgattaaacagcatgatc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2649324 True 206 lncRNA 0.36 1 29727923 29728128
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110488243 ifi44 coding upstream 47728 29672909 ~ 29680195 (+)
LOC110489421 NA coding upstream 70852 29655911 ~ 29657071 (+)
LOC110488242 LOC106570209 coding upstream 207249 29514675 ~ 29520674 (+)
LOC110488239 krit1 coding upstream 220605 29496055 ~ 29507318 (+)
LOC110488238 LOC106570207 coding upstream 236445 29488877 ~ 29491478 (+)
LOC110489422 dus3l coding downstream 2076 29730204 ~ 29745585 (+)
LOC110488250 NA coding downstream 62541 29790669 ~ 29791561 (+)
LOC118946465 NA coding downstream 293927 30022055 ~ 30027657 (+)
LOC118946498 NA coding downstream 303479 30031607 ~ 30032059 (+)
LOC118946528 NA coding downstream 349022 30077150 ~ 30077764 (+)
G2316328 NA non-coding upstream 5327 29722377 ~ 29722596 (+)
G2316323 NA non-coding upstream 11452 29716256 ~ 29716471 (+)
G2316319 NA non-coding upstream 21077 29706552 ~ 29706846 (+)
G2316305 NA non-coding upstream 42607 29685058 ~ 29685316 (+)
G2316299 NA non-coding upstream 63607 29664016 ~ 29664316 (+)
G2316339 NA non-coding downstream 7496 29735624 ~ 29735978 (+)
G2316340 NA non-coding downstream 8017 29736145 ~ 29736396 (+)
G2316355 NA non-coding downstream 14909 29743037 ~ 29743288 (+)
G2316343 NA non-coding downstream 33602 29761730 ~ 29762377 (+)
G2316349 NA non-coding downstream 79533 29807661 ~ 29817565 (+)
G2314987 NA other upstream 1024499 28698740 ~ 28703424 (+)
G2314887 NA other upstream 1164328 28520255 ~ 28563595 (+)
kcng2 LOC106570224 other upstream 1680589 28016566 ~ 28047334 (+)
G2313197 NA other upstream 2234188 27493099 ~ 27493735 (+)
LOC118946485 LOC106570234 other upstream 2525112 27197844 ~ 27202811 (+)
G2316421 NA other downstream 194256 29922384 ~ 29931480 (+)
tmem79a LOC106569868 other downstream 1089900 30817937 ~ 30822555 (+)
G2317455 NA other downstream 1105602 30833730 ~ 30835101 (+)
G2317562 LOC100196669 other downstream 1369491 31097619 ~ 31127687 (+)
G2317685 LOC106569887 other downstream 1493989 31222117 ~ 31223562 (+)

Expression


G2316335 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G2316335 Expression in each Bioproject

Bar chart with 20 bars.
G2316335 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network