G2323207



Basic Information


Item Value
gene id G2323207
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050572.1
NCBI id CM025859.1
chromosome length 41837469
location 35885046 ~ 35885342 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2657109
GTAATAGATTGACTGCAGTCCCTTTTTTAGTGACAGGCCATTGTTCCTCTGTGTATCTCAAATGGCAGTGGTTCCATACCTATAGTCCTGTTACAAAGAGTACTTTCATTGAAACGACCAATTTTAGTCGGCCTTTAACCAGATCCCGAATATATTTGCATGAACTCTGACTGATCACATTTCTGTAGGCTACATGTACAATATTCTGCCCATTTGAAGGAATGTATTTTAGCCCGTTAGTCTGGAACTGCCATACGCATGTAGTTCACTCTAACAACACTCATAAACACAAACACG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2657109 True 297 lncRNA 0.40 1 35885046 35885342

Neighbor


gene id symbol gene type direction distance location
c19h1orf109 ca109 coding downstream 62367 35818837 ~ 35822679 (-)
LOC110489257 clspn coding downstream 108774 35752826 ~ 35776272 (-)
LOC110489305 cssa14h1orf216 coding downstream 144107 35735303 ~ 35740939 (-)
psmb2 psmb2 coding downstream 157620 35716797 ~ 35727426 (-)
LOC110489259 kiaa0319l coding downstream 192168 35656975 ~ 35692878 (-)
LOC110488379 ppce coding upstream 352954 36238296 ~ 36260500 (-)
LOC110488402 NA coding upstream 518916 36404258 ~ 36409492 (-)
LOC118946521 NA coding upstream 533182 36418524 ~ 36422247 (-)
LOC110518543 NA coding upstream 542717 36428059 ~ 36433458 (-)
LOC110488385 ext1c coding upstream 587987 36473329 ~ 36568830 (-)
G2323200 NA non-coding downstream 8352 35876459 ~ 35876694 (-)
G2323199 NA non-coding downstream 8706 35876114 ~ 35876340 (-)
G2323193 NA non-coding downstream 23316 35861463 ~ 35861730 (-)
G2323192 NA non-coding downstream 23864 35860918 ~ 35861182 (-)
G2323187 NA non-coding downstream 48278 35835313 ~ 35836768 (-)
G2323212 NA non-coding upstream 8001 35893343 ~ 35893567 (-)
G2323216 NA non-coding upstream 11528 35896870 ~ 35897076 (-)
G2323217 NA non-coding upstream 11949 35897291 ~ 35897490 (-)
G2323218 NA non-coding upstream 19097 35904439 ~ 35904680 (-)
G2323247 NA non-coding upstream 57898 35943240 ~ 35981232 (-)
G2323152 NA other downstream 70445 35811050 ~ 35814601 (-)
G2322592 NA other downstream 315630 35568749 ~ 35569416 (-)
G2322545 LOC106595184 other downstream 363592 35477914 ~ 35521454 (-)
LOC110489319 LOC106570022 other downstream 530372 35352788 ~ 35356932 (-)
G2322701 LOC106588461 other downstream 692917 35184884 ~ 35192129 (-)
LOC110488406 med30 other upstream 1319257 37204063 ~ 37240288 (-)
si:ch211-153f2.3 LOC104957086 other upstream 1383269 37268611 ~ 37274589 (-)
LOC110517080 tmem42 other upstream 1995597 37880939 ~ 37884444 (-)
G2327199 NA other upstream 3168955 39054297 ~ 39057009 (-)
mrps21 mrps21 other upstream 3264530 39149872 ~ 39234977 (-)

Expression


G2323207 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G2323207 Expression in each Bioproject

Bar chart with 7 bars.
G2323207 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network