G2330160



Basic Information


Item Value
gene id G2330160
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NW_023493657.1
NCBI id JAAXML020000845.1
chromosome length 4173621
location 2951662 ~ 2951910 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2664743
gtgcacctggtgatctgaaatgtgcacctggtgacctgaaatgtgcacctggtgatctaaaatatgcaactggtaaccccaaaaaaaaattttgggatgtttttttgtttatgtttccttactttttcaaagtcactgtgcatttgcaatatgttttaatgggcaggtaccatcacgaatttgtcatgctcaaaattcaaactttactttgctcaaactataccttggtcaacttgtattacatatttc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2664743 True 249 lncRNA 0.36 1 2951662 2951910
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118946645 NA coding downstream 26456 2923371 ~ 2925206 (-)
LOC118946577 NA coding downstream 28862 2922647 ~ 2922800 (-)
LOC118946644 NA coding downstream 52419 2897408 ~ 2899243 (-)
LOC118946576 NA coding downstream 54825 2896684 ~ 2896837 (-)
LOC118946643 NA coding downstream 642730 2307097 ~ 2308932 (-)
LOC118946578 NA coding upstream 4160 2956070 ~ 2956223 (-)
LOC118946647 NA coding upstream 4884 2956794 ~ 2958629 (-)
LOC118946580 NA coding upstream 33486 2985396 ~ 2985549 (-)
LOC118946659 NA coding upstream 34210 2986120 ~ 2987954 (-)
LOC118946709 NA coding upstream 625578 3577488 ~ 3581418 (-)
G2330159 NA non-coding downstream 5644 2945790 ~ 2946018 (-)
G2330153 NA non-coding downstream 8779 2884156 ~ 2942883 (-)
G2330142 NA non-coding downstream 711196 2222753 ~ 2240466 (-)
G2330139 NA non-coding downstream 742191 2209219 ~ 2209471 (-)
G2330137 NA non-coding downstream 746918 2204517 ~ 2204744 (-)
G2330178 NA non-coding upstream 621758 3573668 ~ 3657311 (-)
G2330184 NA non-coding upstream 644020 3595930 ~ 3621789 (-)
LOC118946725 NA non-coding upstream 665868 3592515 ~ 3665893 (-)
G2330187 NA non-coding upstream 707359 3659269 ~ 3660130 (-)
LOC118946704 NA other downstream 770599 2162218 ~ 2182593 (-)
G2330094 NA other downstream 1350781 1556401 ~ 1623113 (-)
G2330207 NA other upstream 963271 3915181 ~ 3940212 (-)

Expression


G2330160 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G2330160 Expression in each Bioproject

Bar chart with 7 bars.
G2330160 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network