G2330184


Basic Information

Item Value
gene id G2330184
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NW_023493657.1
NCBI id JAAXML020000845.1
chromosome length 4173621
location 3595930 ~ 3621789 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU2664786
aggcctcaggttgaattttgtggtgcaggctatgtattcctatggggagagatgacactgtaatctgtgagatcaaaaaacactgttttactgtgaagggttaatgccacacggtcaaggttaggcttgttcagatcgggaggaccttaggaacattcctatggtggaatttttcttctcaccctaacggttctctcactgtcactcaaaagcaaatgacattgtggggcaggcttcattttgggcctaatattctaatggttgctgcgcctagaccgagcgagctacggtcaagcgggatagctcgttgaactcagcacagtctggagactatggtgatgccattttttgtgttgatttcagaatgccattttggtgatggtccctctctgtttaaacatattgcaaatgtacaaaagtcaactagcaagtcagtgtccatcagtcaattagatgtcattatgacaccaaacccactgtttcctactcatttagatgccaactatcatatatgtcagagcagtcccataattcacagcgccttcagttgaaaacataataaaaaggtaaaacacatagttacgttctagctgcgggtccagttcagacattatgtgaagtcctatgtgaggcgaccccgaatcccgagtttcggctcgataggtcatttggtgtccgagaaaaaccctaattggtgctgaaaatccactattttccatgacttgctacggggtccttgaatgagctatcggacagaaactttgggg

Function

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU2664786 True 767 lncRNA 0.44 2 3595930 3621789

Neighbor

gene id symbol gene type direction distance location
LOC118946648 NA coding downstream 11578 3582517 ~ 3584352 (-)
LOC118946581 NA coding downstream 13984 3581793 ~ 3581946 (-)
LOC118946709 NA coding downstream 14512 3577488 ~ 3581418 (-)
LOC118946659 NA coding downstream 607976 2986120 ~ 2987954 (-)
LOC118946580 NA coding downstream 610381 2985396 ~ 2985549 (-)
LOC118946583 NA coding upstream 13204 3634993 ~ 3635146 (-)
LOC118946650 NA coding upstream 13928 3635717 ~ 3637552 (-)
LOC118946725 NA coding upstream 40161 3592515 ~ 3665893 (-)
LOC118946591 NA coding upstream 44477 3666266 ~ 3666418 (-)
LOC118946584 NA coding upstream 273256 3895045 ~ 3895198 (-)
G2330160 NA non-coding downstream 644020 2951662 ~ 2951910 (-)
G2330159 NA non-coding downstream 649912 2945790 ~ 2946018 (-)
G2330153 NA non-coding downstream 653047 2884156 ~ 2942883 (-)
G2330142 NA non-coding downstream 1355464 2222753 ~ 2240466 (-)
G2330187 NA non-coding upstream 37480 3659269 ~ 3660130 (-)
G2330206 NA non-coding upstream 256398 3878187 ~ 3933448 (-)
G2330215 NA non-coding upstream 266102 3887891 ~ 3888458 (-)
G2330205 NA non-coding upstream 291614 3913403 ~ 3934842 (-)
G2330211 NA non-coding upstream 292430 3914219 ~ 3935710 (-)
LOC118946704 NA other downstream 1414867 2162218 ~ 2182593 (-)
G2330094 NA other downstream 1995049 1556401 ~ 1623113 (-)
G2330207 NA other upstream 293392 3915181 ~ 3940212 (-)

Expression

G2330184 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G2330184 Expression in each Bioproject

Bar chart with 20 bars.
G2330184 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network