trnaq-cug-213



Basic Information


Item Value
gene id trnaq-cug-213
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NW_023493658.1
NCBI id JAAXML020000857.1
chromosome length 2864942
location 1190752 ~ 1190823 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>trnaq-cug-213
ggttctatggtgtaatggttagcactcaggactctgaatcctgcgatccgagttcaaatctcggtaggacct

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
trnaq-cug-213 True 72 mRNA 0.49 1 1190752 1190823

Neighbor


gene id symbol gene type direction distance location
trnaq-cug-212 NA coding upstream 261 1190420 ~ 1190491 (+)
trnaq-uug-224 NA coding upstream 437 1190244 ~ 1190315 (+)
trnaq-cug-211 NA coding upstream 977 1189704 ~ 1189775 (+)
trnaq-uug-223 NA coding upstream 1164 1189517 ~ 1189588 (+)
trnaq-cug-210 NA coding upstream 1704 1188977 ~ 1189048 (+)
trnai-aau-87 NA coding downstream 300 1191123 ~ 1191196 (+)
trnaq-cug-214 NA coding downstream 641 1191464 ~ 1191535 (+)
LOC110514778 LOC106591956 coding downstream 11607 1202430 ~ 1222067 (+)
trnai-aau-88 NA coding downstream 47744 1238567 ~ 1238640 (+)
trnai-aau-89 NA coding downstream 49168 1239991 ~ 1240064 (+)
G2330910 NA non-coding upstream 1847 1128216 ~ 1188905 (+)
G2330911 NA non-coding upstream 44717 1124037 ~ 1146035 (+)
G2330909 NA non-coding upstream 64521 1121153 ~ 1126231 (+)
G2330905 NA non-coding upstream 76606 1113916 ~ 1114146 (+)
G2330854 NA non-coding upstream 105703 1084688 ~ 1085049 (+)
G2330949 NA non-coding downstream 6232 1197055 ~ 1389276 (+)
G2330965 NA non-coding downstream 10528 1201351 ~ 1201985 (+)
G2330966 NA non-coding downstream 15543 1206366 ~ 1208980 (+)
G2330967 NA non-coding downstream 19907 1210730 ~ 1211109 (+)
G2330970 NA non-coding downstream 39982 1230805 ~ 1231225 (+)
G2330613 NA other upstream 239345 950910 ~ 951407 (+)
G2330510 NA other upstream 412280 643138 ~ 778472 (+)
G2330523 LOC106601385 other upstream 461329 728306 ~ 729423 (+)
G2330497 LOC106601385 other upstream 649346 540240 ~ 541406 (+)
LOC110497192 LOC106610553 other upstream 897052 274893 ~ 293700 (+)
G2331026 NA other downstream 189524 1380347 ~ 1380812 (+)
G2330948 NA other downstream 194094 1384917 ~ 1386501 (+)
LOC110517176 maml3 other downstream 348508 1539302 ~ 1848885 (+)
G2331702 NA other downstream 1222231 2413054 ~ 2414407 (+)

Expression


trnaq-cug-213 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network