trnaq-cug-214


Basic Information

Item Value
gene id trnaq-cug-214
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NW_023493658.1
NCBI id JAAXML020000857.1
chromosome length 2864942
location 1191464 ~ 1191535 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>trnaq-cug-214
ggttctatggtgtaatggttagcactcaggactctgaatcctgcgatccgagttcaaatctcggtaggacct

Function

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
trnaq-cug-214 True 72 mRNA 0.49 1 1191464 1191535
Loading

Neighbor

gene id symbol gene type direction distance location
trnai-aau-87 NA coding upstream 268 1191123 ~ 1191196 (+)
trnaq-cug-213 NA coding upstream 641 1190752 ~ 1190823 (+)
trnaq-cug-212 NA coding upstream 973 1190420 ~ 1190491 (+)
trnaq-uug-224 NA coding upstream 1149 1190244 ~ 1190315 (+)
trnaq-cug-211 NA coding upstream 1689 1189704 ~ 1189775 (+)
LOC110514778 LOC106591956 coding downstream 10895 1202430 ~ 1222067 (+)
trnai-aau-88 NA coding downstream 47032 1238567 ~ 1238640 (+)
trnai-aau-89 NA coding downstream 48456 1239991 ~ 1240064 (+)
trnai-aau-90 NA coding downstream 49469 1241004 ~ 1241077 (+)
trnai-aau-91 NA coding downstream 50665 1242200 ~ 1242273 (+)
G2330910 NA non-coding upstream 2559 1128216 ~ 1188905 (+)
G2330911 NA non-coding upstream 45429 1124037 ~ 1146035 (+)
G2330909 NA non-coding upstream 65233 1121153 ~ 1126231 (+)
G2330905 NA non-coding upstream 77318 1113916 ~ 1114146 (+)
G2330854 NA non-coding upstream 106415 1084688 ~ 1085049 (+)
G2330949 NA non-coding downstream 5520 1197055 ~ 1389276 (+)
G2330965 NA non-coding downstream 9816 1201351 ~ 1201985 (+)
G2330966 NA non-coding downstream 14831 1206366 ~ 1208980 (+)
G2330967 NA non-coding downstream 19195 1210730 ~ 1211109 (+)
G2330970 NA non-coding downstream 39270 1230805 ~ 1231225 (+)
G2330613 NA other upstream 240057 950910 ~ 951407 (+)
G2330510 NA other upstream 412992 643138 ~ 778472 (+)
G2330523 LOC106601385 other upstream 462041 728306 ~ 729423 (+)
G2330497 LOC106601385 other upstream 650058 540240 ~ 541406 (+)
LOC110497192 LOC106610553 other upstream 897764 274893 ~ 293700 (+)
G2331026 NA other downstream 188812 1380347 ~ 1380812 (+)
G2330948 NA other downstream 193382 1384917 ~ 1386501 (+)
LOC110517176 maml3 other downstream 347796 1539302 ~ 1848885 (+)
G2331702 NA other downstream 1221519 2413054 ~ 2414407 (+)

Expression

trnaq-cug-214 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network