G2330853



Basic Information


Item Value
gene id G2330853
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NW_023493658.1
NCBI id JAAXML020000857.1
chromosome length 2864942
location 1084453 ~ 1085806 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2665700
gtgtagtagaccttacagtgaaatgctgaatacaacaggtgcagtagacctcacagtgaaatgctgactacaacaggtgtagtagaccttacagtgaaatgctgaatacaacaggtgtagtagaccttacagtgaaatgctgaatacaacaggtgtagtagaccttacagtgaaatgctgacttacaacaggtgtagtagaccttacagtgaaatgctgaatacaacaggtgtagtagaccttacagtgtaatgctgacatacaacaggtgtagtagaccttacagtgaaatgctgatttacaacaggtgtagtagaccttacagtgaaatgctgacttacaacaggtgtagtagaccttacagtgaaatgctgaatacaacaggtgtagtagaccttacagtgaaatgctgacttacaacaggtgtagtagacctcacagtgaaattctgatttacaacaggtgtagtagacctt

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2665700 True 476 lncRNA 0.41 3 1084453 1085806

Neighbor


gene id symbol gene type direction distance location
LOC110513303 NA coding upstream 2383 1081017 ~ 1082185 (+)
LOC110497258 LOC106602131 coding upstream 21921 1026012 ~ 1062532 (+)
LOC110519449 LOC106591691 coding upstream 450713 630236 ~ 633740 (+)
LOC110519450 LOC106602136 coding upstream 478425 490447 ~ 606028 (+)
LOC110516542 LOC106601385 coding upstream 641985 439986 ~ 442468 (+)
trnaq-uug-131 NA coding downstream 33177 1118983 ~ 1119054 (+)
trnaq-cug-121 NA coding downstream 33364 1119170 ~ 1119241 (+)
trnaq-uug-132 NA coding downstream 33903 1119709 ~ 1119780 (+)
trnaq-cug-122 NA coding downstream 34090 1119896 ~ 1119967 (+)
trnaq-uug-133 NA coding downstream 34628 1120434 ~ 1120505 (+)
G2330835 NA non-coding upstream 70099 1014008 ~ 1014354 (+)
G2330828 NA non-coding upstream 79154 1004035 ~ 1005299 (+)
G2330827 NA non-coding upstream 87415 996587 ~ 997038 (+)
G2330826 NA non-coding upstream 90029 994045 ~ 994424 (+)
G2330905 NA non-coding downstream 28110 1113916 ~ 1114146 (+)
G2330909 NA non-coding downstream 35347 1121153 ~ 1126231 (+)
G2330911 NA non-coding downstream 38231 1124037 ~ 1146035 (+)
G2330910 NA non-coding downstream 42410 1128216 ~ 1188905 (+)
G2330949 NA non-coding downstream 111249 1197055 ~ 1389276 (+)
G2330613 NA other upstream 133046 950910 ~ 951407 (+)
G2330510 NA other upstream 305981 643138 ~ 778472 (+)
G2330523 LOC106601385 other upstream 355030 728306 ~ 729423 (+)
G2330497 LOC106601385 other upstream 543047 540240 ~ 541406 (+)
LOC110497192 LOC106610553 other upstream 790753 274893 ~ 293700 (+)
LOC110514778 LOC106591956 other downstream 116646 1202430 ~ 1222067 (+)
G2331026 NA other downstream 294541 1380347 ~ 1380812 (+)
G2330948 NA other downstream 299111 1384917 ~ 1386501 (+)
LOC110517176 maml3 other downstream 453525 1539302 ~ 1848885 (+)
G2331702 NA other downstream 1327248 2413054 ~ 2414407 (+)

Expression


G2330853 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G2330853 Expression in each Bioproject

Bar chart with 14 bars.
G2330853 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.

Co-expression Network